                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:102 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-10.00 kcal/mol
Antiterminator: Size=22 nt.     Delta G= -6.40 kcal/mol
Anti-antiterminator:   Size=71 nt.     Delta G=-12.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGCAGCGCAAgcgccggcctggcgctcatgcgtatgccagggtggtcgcgcacagaatacagatagcggattcataaatcaaataatgaaa
tggtaatcccaagtattaggaagttatcgaattcaccctcgggcctggaaatacgcttgatattggccatattgattgacggccatccaggctgttcttt
attattttccacatatatagagttcatatcctatattttgatattttccgggcatgatgacgccgcatgggcgatgtgctcgaatgaagggaccgacagg
aggggatcATG

    BP3320 Gene: BP3320     GI: 33594213     BI number: BP3320     GOG: COG5553     Description: conserved hypothetical protei ca t  c t  c a  c at gc cg tg a  g t  | t  | g  | a  | a  | gc gc at tg tg |  a |  a |  a |  t |  a a  c tg gc                   c at                 t  c at                 a  a cg                  cg c  a       ga        cg c  t      t  t       gc ta       t  t       gt at       a  g       cg at       t  a       at |  g      a  c       gt tg        cg       t  c gc        cg       t  t gc        gc        at ta        gc        gt at        ta        ta                         ttattttccacatatatagagttcatatcctatattttgatattttccgggcatgatgacgccgcatgggcgatgtgctcgaatgaagggaccgacaggaggggatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG5553 Predicted metal-dependent enzyme of the double-stranded beta helix superfamily ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_pertussis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:108 nt.     Distance to run of Ts=2 nt.   Size=38 nt.     Delta G=-12.10 kcal/mol Antiterminator: Size=27 nt.     Delta G= -4.81 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTGCAGCGCAAgcgccggcctggcgctcatgcgtatgccagggtggtcgcgcacagaatacagatagcggattcataaatcaaataatgaaa tggtaatcccaagtattaggaagttatcgaattcaccctcgggcctggaaatacgcttgatattggccatattgattgacggccatccaggctgttcttt attattttccacatatatagagttcatatcctatattttgatattttccgggcatgatgacgccgcatgggcgatgtgctcgaatgaagggaccgacagg aggggatcATG     BP3320 Gene: BP3320     GI: 33594213     BI number: BP3320     GOG: COG5553     Description: conserved hypothetical protei            ga           t  t           t  t           a  g           t  a           a  c   g        cg c  c       cg a  t       gc t  t       gc a  g       ta a  a      t  t a  t      a  c g  a      t  | g  t      a  | t  t       gc cg        ta cg        tg gc        cg gc        gc             tgttctttattattttccacatatatagagttcatatcctatattttgatattttccgggcatgatgacgccgcatgggcgatgtgctcgaatgaagggaccgacaggaggggatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG5553 Predicted metal-dependent enzyme of the double-stranded beta helix superfamily ... can be seen here     ..................................................................................................................