                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:39 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G= -6.10 kcal/mol
Antiterminator: Size=15 nt.     Delta G= -3.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tacagcgcctgagcagccgcgagcgtagcgcgagatccgaccagggtgccgacatctccccggctctgccagagttcatgtcggtatccgccatcgaccc
agacccgacagatcgtccagcccggcgggccggaccagtagtaatcgtccctctgctgccaagccgccgcatccaccatgatccgcccccttctcggcca
gaaacggggccaagttgaacggattctatgctcgcatacactgtatgtccatacagttttttgggccacaattggccttcgagcatgaccgagtttcaat
TTG

    BP3353 --- BP3354 Gene: BP3353     GI: 33594242     BI number: BP3353     GOG: -------     Description: putative phage-related hypothetical protein (partial) Gene: BP3354     GI: 33594243     BI number: BP3354     GOG: -------     Description: phage-related hypothetical protei            tc   c       g  c a  t       ta cg        at at        ta ta        gc at        ta cg        cg gt        at             tttttgggccacaattggccttcgagcatgaccgagtttcaatTTG     ..................................................................................................................