                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:19 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -7.50 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-11.21 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GACACACCAGATCACAGTAAAGCGCTGGCCATACAAGGACTGGGTAGGGACGATTGAG
CATGCAGAAGATCAGCTATAAggcgtctcacgttgagcaccgtgcgcgtgcatacccacctattggtgaccagctggatgctgcc
atgaagctggcggctgcgctgcaggtggcaggcgtgccgttgcccgatgaggtggctcgctggatcgatcagtgcaaggcagtgaagcataggtacccga
aatccaatgaatgaacgggcccatagggggctttttttgtgttgagagtgaagcatgATG

    BP3359 --- BP3358 --- BP3357 --- BP3356 --- BP3355 Gene: BP3359     GI: 33594248     BI number: BP3359     GOG: -------     Description: phage-related hypothetical protein Gene: BP3358     GI: 33594247     BI number: BP3358     GOG: -------     Description: phage-related hypothetical protein Gene: BP3357     GI: 33594246     BI number: BP3357     GOG: -------     Description: phage-related conserved hypothetical protein Gene: BP3356     GI: 33594245     BI number: BP3356     GOG: -------     Description: putative phage lysozyme Gene: BP3355     GI: 33594244     BI number: BP3355     GOG: NOG12240     Description: phage-related conserved hypothetical protei   a a  g cg gc ta g  g       cg at       c  a cg       c  a ta       a  a a  |      t  t g  |       gc c  |       gc t  |      a  a a  |       ta g  |       at g  |       cg ta       |  a cg       g  a gc       a  t |  a      a  g        a c  t      g  a      t  g ta        ta       a  g cg        gc        cg g  g      |  g       cg gt       a  g       cg ta        cg        gc gc        gc        gt gc        gc        gt                         tttttgtgttgagagtgaagcatgATG     ..................................................................................................................