                                                                        Gene putatively regulated by attenuation in B_pertussis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:31 nt.     Distance to run of Ts=3 nt.   Size=35 nt.     Delta G=-20.60 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-12.00 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -9.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGTTCACGCCCACGTGAGCTTCGTTCTTGATCGGGAGCAGTACGACGTTTATCAGCG
GTTCTGCTCCATCGATCTCAACGGTTACGCGGGGTGGTTCCTCATGGCGATGAACGGG
CCGGGCGGGCTGAAACTACGGAAGGTTCGATGGTTGCTTCCCGTCCCGCGTGAAGAAC
GTATCCCCGGTGACCTATGGCGTGTCTCGGGCGAACTGGAATCGATGAGCGATGAGTA
AtcccgaacgccgggatctcgtcgcggcattttttcattatccgcacattgtcgttggtgcttgacccATG

    BP3364 --- BP3363 --- BP3362 --- BP3361 Gene: BP3364     GI: 33594252     BI number: BP3364     GOG: -------     Description: phage-related conserved hypothetical protein Gene: BP3363     GI: 33594251     BI number: BP3363     GOG: -------     Description: phage-related conserved hypothetical protein Gene: BP3362     GI: 33594250     BI number: BP3362     GOG: COG4733     Description: phage-related conserved hypothetical protein Gene: BP3361     GI: 33594249     BI number: BP3361     GOG: -------     Description: phage-related hypothetical protei             G           T  A           A  G            GC            CG            TA            AT           A  G           G  |        c           G  |      a  g   G        TA       a  c T  G       CG        gc A  C       AT        cg T  G      A  A       cg C  T      G  A       cg CG       C  t       ta AT        Gc        At GC        Gc       A  | T  |       Gc       T  | GT        Cg        Gc GC        Ta        At CG       C  |       Gc CG       T  |       Tg CG       G  |       At |  C       Ta        Gc CG        Gc        Cg TA        Cg        Gc                         ggcattttttcattatccgcacattgtcgttggtgcttgacccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4733 Phage-related protein, tail component ... can be seen here     ..................................................................................................................