                                                                        Gene putatively regulated by attenuation in B_burgdorferi

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:189 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G= -8.10 kcal/mol
Antiterminator: Size=37 nt.     Delta G=-13.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCCAAGTAAACGGTGTTGTAAAAGGCGATGTTTTTTTGATTCTTAAAGAAGGTGCTT
TAAACAGTGATACTAGAGATTCTGGTTTTATTGTTTACAAAAAATCAGATATTTTAGG
CGAGATTTTAATTGAGGATATAAGTGATTATATTTCTAGAGGCATTGTAAAATCTTCT
ACCTTTTTAAAGGATTATGTTCAAGAAGGAGCCACTGTGCTTATAAAAAGATAGtttgac
acttgttgttaatttgtgatttaataattctagtaagaataaaatcaaaaaattggaggattttgtATG

    BB0057 --- BB0056 --- BB0055 --- BB0054 Gene: BB0057     GI: 15594403     BI number: BB0057     GOG: COG0057     Description: glyceraldehyde 3-phosphate dehydrogenase (gap) Gene: BB0056     GI: 15594402     BI number: BB0056     GOG: COG0126     Description: phosphoglycerate kinase (pgk) Gene: BB0055     GI: 15594401     BI number: BB0055     GOG: COG0149     Description: triosephosphate isomerase Gene: BB0054     GI: 15594400     BI number: BB0054     GOG: COG1314     Description: B. burgdorferi predicted coding region BB005   A G  T A  T GC AT        TT TG       T  A CG        GC AT        TA T  T       TA AT       A  | GT        TA TA        TA GT        TA AT        TA CG        GT AT        GC AT        TA AT        CG TA        TA             TATTTTAGGCGAGATTTTAATTGAGGATATAAGTGATTATATTTCTAGAGGCATTGTAAAATCTTCTACCTTTTTAAAGGATTATGTTCAAGAAGGAGCCACTGTGCTTATAAAAAGATAGtttgacacttgttgttaatttgtgatttaataattctagtaagaataaaatcaaaaaattggaggattttgtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG0057 Glyceraldehyde-3-phosphate dehydrogenase/erythrose-4-phosphate dehydrogenase ... can be seen here [G] COG0126 3-phosphoglycerate kinase ... can be seen here [G] COG0149 Triosephosphate isomerase ... can be seen here [U] COG1314 Preprotein translocase subunit SecG ... can be seen here     ..................................................................................................................