                                                                        Gene putatively regulated by attenuation in B_burgdorferi

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:51 nt.    Distance to gene:139 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-11.90 kcal/mol
Antiterminator:    Distance from promoter:14 nt. Size=48 nt.     Delta G= -4.60 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -8.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAGG-TAAAAT. It has a score value of 77.64 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAGGTTGGAAAAAATACTTATAAAATTTTGAGAGGAAACGATTCTTTTAAAATTAC
ATTTTAGtaaattttagttttgggttaagagttgatcttagcccttttttgttttacatataattgtaaagcttttagattgtaatgattttatt
ttatgcaaatatttgtgtgttaatttgcaagttaaaatattttgattaaataaattttattgttattaggaaagaataaaaggaataagtttgaattAT
G

    BB0103 Gene: BB0103     GI: 15594449     BI number: BB0103     GOG: COG2236     Description: B. burgdorferi predicted coding region BB010            AG           T  t            Ta            Ta            Ta            At           |  t           C  t            At            Ta   C        Tg A  G       At A  A       At AT        At GT        At         t GC        Tg       t  g AT        Tg       g  a GT       |  g       at AT       |  t       gc GT       |  t       at TA        Ta        at TA        Ta        ta TA        Cg        tg TA        Ta        gc AT        Tg        gc AT        At        gc                         ttttttgttttacatataattgtaaagcttttagattgtaatgattttattttatgcaaatatttgtgtgttaatttgcaagttaaaatattttgattaaataaattttattgttattaggaaagaataaaaggaataagtttgaattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG2236 Predicted phosphoribosyltransferases ... can be seen here     ..................................................................................................................