Gene putatively regulated by attenuation in B_burgdorferi

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:86 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-15.50 kcal/mol

                                                                        Nomenclature/Definitions

AAAGCATCTTATGCTCAAATAAAAGATGCTACAATGACAGATGAGGTTGTAGCAGCAA
CAACTAATAGTATTTTAACACAATCTGCAATGGCAATGATTGCGCAGGCTAATCAAGT
TCCCCAATATGTTTTGTCATTGCTTAGATAAaattctagtttaattggtataaattgtattaacaaaagatccttta
aaggatcttttgtttttttatttcagatcggcaaaaatttaataattttagtataatttataatgatgtgttataaagcataatgcaggcttattgagga
gtttgctTTG

    BB0146 --- BB0145 --- BB0144


Gene: BB0146     GI: 15594491     BI number: BB0146     GOG: COG4175     Description: glycine betaine, L-proline ABC transporter, ATP-binding protein (proV)
Gene: BB0145     GI: 15594490     BI number: BB0145     GOG: COG4176     Description: glycine betaine, L-proline ABC transporter, permease protein (proW)
Gene: BB0144     GI: 15594489     BI number: BB0144     GOG: COG2113     Description: glycine betaine, L-proline ABC transporter, glycine/betaine/L-proline-binding protein (proX


          ta
         t  a
          ta
          cg
          cg
          ta
          at
          gc
          at
          at
          at
          at
          cg
          at
          at
            tttttatttcagatcggcaaaaatttaataattttagtataatttataatgatgtgttataaagcataatgcaggcttattgaggagtttgctTTG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG4175 ABC-type proline/glycine betaine transport system, ATPase component ... can be seen here
[E] COG4176 ABC-type proline/glycine betaine transport system, permease component ... can be seen here
[E] COG2113 ABC-type proline/glycine betaine transport systems, periplasmic components ... can be seen here

    ..................................................................................................................