Gene putatively regulated by attenuation in B_burgdorferi

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:157 nt.    Distance to gene:23 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G= -9.90 kcal/mol
Antiterminator:    Distance from promoter:123 nt. Size=47 nt.     Delta G= -8.50 kcal/mol
Anti-antiterminator:    Distance from promoter:115 nt.    Size=32 nt.     Delta G=-10.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-aaaaat. It has a score value of 80.99 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacaaacatatatacttatgaaaaaattaaggtactagaataaaaatgctgctgtagctcagttggtagagcataggactgaaaatccttgtgtcagg
agttcgattctcctcggcagcatgcatttatttaaattacaattGTCGCTGTAGCTCAGTTGGTAGAGCATAGGAC
TGAAAATCCTTGTGTCAGGAGTTCGATTCTCCTCGGCGACAtttatttaaagattaaaaggatctcaaaG
TG

    BB0204


Gene: BB0205     GI: 15594550     BI number: BB0205     GOG: -------     Description: B. burgdorferi predicted coding region BB020


            A
          G  A
          T  A
          C  A
           AT
           GC
           GC
           AT
          T  |
           AT
 TG        CG         G
T  G       GT       C  A
G  T      A  G      T  T
A  A      G  |      T  T
 CG       A  |       GC
 TA       T  |       AT
 CG        GT        GC
 GC        GC        GC
A  |       TA        AT
 TA       T  G      |  C
 GT       G  |       CG
 TA       A  |       TG
 CG        CG        GC
G  |       TA       |  G
 CG        CG        TA
 TA        GT        GC
 GC        AT        TA
                        tttatttaaagattaaaaggatctcaaaGTG


    ..................................................................................................................