                                                                        Gene putatively regulated by attenuation in B_burgdorferi

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:97 nt.    Distance to gene:64 nt.     Distance to run of Ts=1 nt.   Size=35 nt.     Delta G=-14.30 kcal/mol
Antiterminator:    Distance from promoter:67 nt. Size=49 nt.     Delta G= -4.69 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTAAT-TGTAAT. It has a score value of 66.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTAATCAAAGTATTTATTTCAGTGTAATTCAAAGACATTTTTATCAAatcctaattctttcaa
ggtgtttatatctaagctttaaatttttattttatgtattaaactagtactattaataatagtttatttccatgatatgtagtattatggaaataaagtt
tattgacaataaatagtttaaatgtagttttgttaatagcttaagcttaataataagagttcatagaATG

    BB0346 --- BB0345 --- BB0344 --- BB0343 --- BB0342 --- BB0341 --- BB0340 --- BB0339 --- BB0338 Gene: BB0346     GI: 15594691     BI number: BB0346     GOG: COG2834     Description: B. burgdorferi predicted coding region BB0346 Gene: BB0345     GI: 15594690     BI number: BB0345     GOG: COG1426     Description: B. burgdorferi predicted coding region BB0345 Gene: BB0344     GI: 15594689     BI number: BB0344     GOG: COG0210     Description: DNA helicase (uvrD) Gene: BB0343     GI: 15594688     BI number: BB0343     GOG: COG0721     Description: glu-tRNA amidotransferase, subunit C (gluC) Gene: BB0342     GI: 15594687     BI number: BB0342     GOG: COG0154     Description: glu-tRNA amidotransferase, subunit A (gluA) Gene: BB0341     GI: 15594686     BI number: BB0341     GOG: COG0064     Description: glu-tRNA amidotransferase, subunit B (gatB) Gene: BB0340     GI: 15594685     BI number: BB0340     GOG: NOG48109     Description: B. burgdorferi predicted coding region BB0340 Gene: BB0339     GI: 15594684     BI number: BB0339     GOG: COG0102     Description: ribosomal protein L13 (rplM) Gene: BB0338     GI: 15594683     BI number: BB0338     GOG: COG0103     Description: ribosomal protein S9 (rpsI   a a  t ta ta at ta cg at |  t        t |  t      g  a t  a       tg g  t       at a  t       ta t  t       at c  c       gt a  c       ta a  a       at at        cg tg        cg ta        ta at        ta ta        ta gt        at tg        ta at        ta ta        ta             gtttattgacaataaatagtttaaatgtagttttgttaatagcttaagcttaataataagagttcatagaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG2834 Outer membrane lipoprotein-sorting protein ... can be seen here [S] COG1426 Uncharacterized protein conserved in bacteria ... can be seen here [L] COG0210 Superfamily I DNA and RNA helicases ... can be seen here [J] COG0721 Asp-tRNAAsn/Glu-tRNAGln amidotransferase C subunit ... can be seen here [J] COG0154 Asp-tRNAAsn/Glu-tRNAGln amidotransferase A subunit and related amidases ... can be seen here [J] COG0064 Asp-tRNAAsn/Glu-tRNAGln amidotransferase B subunit (PET112 homolog) ... can be seen here [J] COG0102 Ribosomal protein L13 ... can be seen here [J] COG0103 Ribosomal protein S9 ... can be seen here     ..................................................................................................................