                                                                        Gene putatively regulated by attenuation in B_burgdorferi

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:135 nt.     Distance to run of Ts=1 nt.   Size=31 nt.     Delta G= -8.40 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -3.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATAATAATGTTTGGGAAGGTGGAAAAGTTGTTCAAATGGGATTAAGAGATGGTGTTAT
TGGGCTGCCTAATGCGAATGAATTTGAATACATAAAAGTTCTTGAGAGAAAAATAATC
AATAAAGAGATCATTGTTCCTTGCAATCAGGAGGAATATGAAATTTTTATAAAACAAA
TATTAAAGTTATAAacttttgaaatagaaagattttaattttccagtttttaattttttaattatgttatatttattgtgttataataaa
tagaagtacatttctgttgttttagaggatttagcaTTG

    BB0381 --- BB0380 --- BB0379 --- BB0378 Gene: BB0381     GI: 15594726     BI number: BB0381     GOG: COG1626     Description: conserved hypothetical protein Gene: BB0380     GI: 15594725     BI number: BB0380     GOG: COG2239     Description: Mg2+ transport protein (mgtE) Gene: BB0379     GI: 15594724     BI number: BB0379     GOG: COG0537     Description: protein kinase C1 inhibitor (pkcI) Gene: BB0378     GI: 15594723     BI number: BB0378     GOG: -------     Description: B. burgdorferi predicted coding region BB037 AA T  A A  G A  A       AT CG       A  C TA       C  A AT       G  G A  C       TG TA        TA AT        CG AT        CG A  G       TA AT        TA AT        GT GC       T  | A  |       TA GC        AT AT        CG GT        TA             AATTTTTATAAAACAAATATTAAAGTTATAAacttttgaaatagaaagattttaattttccagtttttaattttttaattatgttatatttattgtgttataataaatagaagtacatttctgttgttttagaggatttagcaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1626 Neutral trehalase ... can be seen here [P] COG2239 Mg/Co/Ni transporter MgtE (contains CBS domain) ... can be seen here [FGR] COG0537 Diadenosine tetraphosphate (Ap4A) hydrolase and other HIT family hydrolases ... can be seen here     ..................................................................................................................