                                                                        Gene putatively regulated by attenuation in B_burgdorferi

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:145 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-11.30 kcal/mol
Antiterminator: Size=63 nt.     Delta G=-11.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

agctgatttgtgaaaaatctttttaattctttaaagatgttttaaagggttttttaattgttgtaatttgaatttaaattaatcttgcaaaagggtttaa
atttggatattatggtgatgtaggaaaaattatttttcctactactgtgtttttattaatgctagaagtatttttttaaaagggattattaaaattttat
tttataaataaagaatactacttgttagtaaaataaagttaatattttaatttttaaaaaatttagaatttttaaaaaaaatataaggagaggattaatt
TTG

    BB0384 --- BB0383 --- BB0382 Gene: BB0384     GI: 15594729     BI number: BB0384     GOG: COG1744     Description: basic membrane protein C (bmpC) Gene: BB0383     GI: 15594728     BI number: BB0383     GOG: COG1744     Description: basic membrane protein A (bmpA) Gene: BB0382     GI: 15594727     BI number: BB0382     GOG: COG1744     Description: basic membrane protein B (bmpB ca g  a ta ta cg tg a  | a  | t  | tg at at at ta ta         t ta       t  a at        at at        at g  t       at t  g       at tg        at ta        gc at        gc |  a       at |  t       ta at        gc ta       t  | gt       a  | tg        gt tg        ta g  t       gc t  g       gt ta        tg at        at             gtttttattaatgctagaagtatttttttaaaagggattattaaaattttattttataaataaagaatactacttgttagtaaaataaagttaatattttaatttttaaaaaatttagaatttttaaaaaaaatataaggagaggattaattTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1744 Uncharacterized ABC-type transport system, periplasmic component/surface lipoprotein ... can be seen here [R] COG1744 Uncharacterized ABC-type transport system, periplasmic component/surface lipoprotein ... can be seen here [R] COG1744 Uncharacterized ABC-type transport system, periplasmic component/surface lipoprotein ... can be seen here     ..................................................................................................................