                                                                        Gene putatively regulated by attenuation in B_burgdorferi

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:70 nt.    Distance to gene:23 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G= -7.80 kcal/mol
Antiterminator:    Distance from promoter:41 nt. Size=43 nt.     Delta G=-10.00 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G=-13.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgttt-taagat. It has a score value of 78.98 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgtttttttctaaacaatcaactaagataataaagagttttatagggaattagtgcccttatagctcagttggtagagcaccaccatggtaaggtgggg
gtcgtcggttcaagtccgattgagggcttttattggtagttaggagttttgttatATG

    Trp Gene: BB0396     GI: 15594741     BI number: BB0396     GOG: COG0267     Description: ribosomal protein L33 (rpmG ta t  g a  t a  g gc gc gc at t  t a  a t  t t  |        g ta       g  t tg       t  a gc       a  a at        cg gc        cg a  |       at a  |       cg a  |       cg t  |      |  g        g a  |      a  g      a  t a  |       cg       a  c t  |       gt       c  c a  |      |  c       tg g  |      |  g       ta a  |       at        gt a  |       gc        gt ta       |  g       cg cg       a  g       ta at       t  t      g  g at        gt        cg cg        gc        tg tg        ta        gc at        ta        gt                         tttattggtagttaggagttttgttatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0267 Ribosomal protein L33 ... can be seen here     ..................................................................................................................