                                                                        Gene putatively regulated by attenuation in B_burgdorferi

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:63 nt.     Distance to run of Ts=2 nt.   Size=31 nt.     Delta G= -8.10 kcal/mol
Antiterminator: Size=73 nt.     Delta G=-16.00 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G= -7.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATAGGTTAGAAGTGTAAGTATAGCAATATATTAAGCTGACTAATACTAATTACCCGTA
TCTTTGGCCATAtttttgtcttccttgtaaaaaCCCTGGTGGTTAAAGAAAAGAGGAAACACCTGTT
ATCATTCCGAACACAGAAGTTAAGCTCTTATTCGCTGATGGTACTGCGAGTTCGCGGG
AGAGTAGGTTATTGCCAGGGtttttgtttttatactttaaaccttgaatttattgtgtatatttatttttacacagtggtaaaac
tgttgtttttaataagggaattttaaaataacATG

    BB0420 --- BB0419 Gene: BB0420     GI: 15594765     BI number: BB0420     GOG: COG0642,COG0784     Description: sensory transduction histidine kinase, putative Gene: BB0419     GI: 15594764     BI number: BB0419     GOG: COG3706     Description: response regulatory protein (rrp-1            GT           A  T            GC            CG            GC            TG            CG           A  G           T  A           G  |           G  |           T  | TA       A  | T  A      G  | G  G      T  | A  C      C  | AT       G  | GC        CG AT        TA C  T       TG A  A       AT C  |       TA AT        TG AT        CG GC       |  T CG       |  T |  C      |  A C  T      |  T       tt TG       T  T      t  a TA        CG       t  t AT        GC        ta CG       |  C       gc TG       A  A      |  t AT       A  G      t  t TA        TG       t  t |  C       TG        ta |  T       Gt        ta TG        At        ta GC        At        Gc TG        Gt        Gc C  A       At        Gt CG        Cg        At AT        At        Cg                         aatttattgtgtatatttatttttacacagtggtaaaactgttgtttttaataagggaattttaaaataacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG0642 Signal transduction histidine kinase ... can be seen here [T] COG0784 FOG: CheY-like receiver ... can be seen here [T] COG3706 Response regulator containing a CheY-like receiver domain and a GGDEF domain ... can be seen here     ..................................................................................................................