                                                                        Gene putatively regulated by attenuation in B_burgdorferi

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:31 nt.    Distance to gene:64 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-14.00 kcal/mol
Antiterminator:    Distance from promoter:16 nt. Size=27 nt.     Delta G= -3.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGATA-CAAAAT. It has a score value of 74.3 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGATAATGACAGCTTGGTTTCTGTTTCAAAATTTATTAAATAAagaattggtttttcttgtttaag
aatgttccacgtggaacattctttttttttattcttaaattgtaattcaatattataacctggtaaaattttgtgttgtaggaggttttgacaatATG

    BB0434 --- BB0433 Gene: BB0434     GI: 15594779     BI number: BB0434     GOG: COG1475     Description: stage 0 sporulation protein J (spo0J) Gene: BB0433     GI: 15594778     BI number: BB0433     GOG: -------     Description: B. burgdorferi predicted coding region BB043 tt g  t       cg ta       a  t ta        cg cg        cg ta        ta ta        ta |  t       gc t  g       ta t  t       at t  t       at gc        gc gc        at ta        at             tttttttattcttaaattgtaattcaatattataacctggtaaaattttgtgttgtaggaggttttgacaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1475 Predicted transcriptional regulators ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_burgdorferi                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:167 nt.    Distance to gene:71 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G= -8.60 kcal/mol Antiterminator:    Distance from promoter:129 nt. Size=27 nt.     Delta G= -3.80 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TTGATG-GATGAT. It has a score value of 60.91 and is shown in blue Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTGATGCTATAGCAGTTTCAGAGGATGATGAAATCTTGCTTGTAAGTAAACGTTCAAA AGCTTTAAGAACAGTAGCTGGAAAAGTATCTGAACAAGGCAAAGATGCTAGAGGAATT CAAGTATTATTTCTTGATAATGACAGCTTGGTTTCTGTTTCAAAATTTATTAAATAAa gaattggtttttcttgtttaagaatgttccacgtggaacattctttttttttattcttaaattgtaattcaatattataacctggtaaaattttgtgttg taggaggttttgacaatATG     BB0434 --- BB0433 Gene: BB0434     GI: 15594779     BI number: BB0434     GOG: COG1475     Description: stage 0 sporulation protein J (spo0J) Gene: BB0433     GI: 15594778     BI number: BB0433     GOG: -------     Description: B. burgdorferi predicted coding region BB043 TA A  A Aa Ag Ta        cg Ta       a  t At        cg |  t       cg T  g       ta T  g       ta T  t       gc At        ta At        at At        at             ctttttttttattcttaaattgtaattcaatattataacctggtaaaattttgtgttgtaggaggttttgacaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1475 Predicted transcriptional regulators ... can be seen here     ..................................................................................................................