                                                                        Gene putatively regulated by attenuation in B_burgdorferi

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:68 nt.    Distance to gene:48 nt.     Distance to run of Ts=2 nt.   Size=35 nt.     Delta G= -8.90 kcal/mol
Antiterminator:    Distance from promoter:27 nt. Size=44 nt.     Delta G= -7.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: CTGTTT-TATACT. It has a score value of 62.25 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTGTTTTTAGACAAAGAAGTGGTGGGTATACTCGGATGATTAAATTAGGAAAAAGATA
TGGAGATGCGGCTGAAATGGCTATCCTAGAATTAGTTGAAAAGCCTTTAAAAGTTGAA
TAAttaataatttgagggcactgttttaaagattaaattttaaattgcttttaaacagcataggagttaaatgatATG

    BB0504 --- BB0505 --- BB0506 Gene: BB0504     GI: 15594849     BI number: BB0504     GOG: COG1418     Description: conserved hypothetical protein Gene: BB0505     GI: 15594850     BI number: BB0505     GOG: COG1692     Description: conserved hypothetical protein Gene: BB0506     GI: 15594851     BI number: BB0506     GOG: COG1189     Description: hemolysin (tlyA   A T  T C  C GC GT TA        TA |  G      A  A A  A       At A  A       Gt AT        Ta GT        Ta TA        Gt CG       |  a GT       A  a GT        At CG        At G  A       At T  A       Tg A  A       Ta G  A       Tg A  G       Cg GC        Cg GC        Gc             actgttttaaagattaaattttaaattgcttttaaacagcataggagttaaatgatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1418 Predicted HD superfamily hydrolase ... can be seen here [S] COG1692 Uncharacterized protein conserved in bacteria ... can be seen here [J] COG1189 Predicted rRNA methylase ... can be seen here     ..................................................................................................................