                                                                        Gene putatively regulated by attenuation in B_burgdorferi

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:170 nt.    Distance to gene:23 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-15.00 kcal/mol
Antiterminator:    Distance from promoter:146 nt. Size=38 nt.     Delta G= -3.30 kcal/mol
Anti-antiterminator:    Distance from promoter:130 nt.    Size=36 nt.     Delta G= -3.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTAAA-TAGAAT. It has a score value of 78.98 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTAAATATTGAGATTAATTTAATAGAATCAAAAACCACTTTTTATATTAATGGCAGG
GGAGCGGATATTGTAATTGAAGGTTTTAATATAGGTGGTTTTGGCGAAATTTCACCTT
ATGTGTTAAATAATTTTGGTATTTTTATTCCATGTTCTGTTTTTGAGGTTAATATAAA
CAAACTTATGAGTCGATCTTAAgcattgaatattagttttagcaatgttaagattaatattcaaatttttaagagaggcctgaa
gtttagatATG

    BB0515 Gene: BB0515     GI: 15594860     BI number: BB0515     GOG: COG0492     Description: thioredoxin reductase (trxB             A         a AA       T  A      a  t C  A      T  g       cg A  C      C  c       gt AT        Ta        at AT        At        ta TA        Gt        ta AT        Cg        tg |  G       Ta        ta |  A      G  a       gt TG       A  t       at AT       G  a       ta A  C      T  t       ta T  G      A  t       at TA       T  |       ta GT        Ta        at GC        Cg        at AT        At        gc GT        At        ta TA        At        ta                         atttttaagagaggcctgaagtttagatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0492 Thioredoxin reductase ... can be seen here     ..................................................................................................................