                                                                        Gene putatively regulated by attenuation in B_burgdorferi

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:70 nt.    Distance to gene:134 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-16.80 kcal/mol
Antiterminator:    Distance from promoter:64 nt. Size=22 nt.     Delta G= -5.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAGG-AAATAT. It has a score value of 66.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAGGACAGAAGATCAGTTGGTAAATATTTAACAGCAAAACSTATTTAAcaaatatgaccaa
gaaaagctttaatttgttttttagatagtattaaaagcccttttgcttttaaagcaggagggcttatttatgtttatgactagcttttagagtaataaat
tttgttttataatcatcaagatggtttatttaattttaaaattcaacagcattgaagttttgtattttgattattattagatttagtgttattttgctgc
tTTG

    BB0542 Gene: BB0542     GI: 15594887     BI number: BB0542     GOG: COG0457     Description: B. burgdorferi predicted coding region BB054             t           t  a            ta tt        ta c  t       cg c  t       gc cg        ta gc        tg at        tg at        ta at        cg at        cg ta        cg ta        gc             ttatttatgtttatgactagcttttagagtaataaattttgttttataatcatcaagatggtttatttaattttaaaattcaacagcattgaagttttgtattttgattattattagatttagtgttattttgctgctTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0457 FOG: TPR repeat ... can be seen here     ..................................................................................................................