                                                                        Gene putatively regulated by attenuation in B_burgdorferi

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:143 nt.    Distance to gene:37 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-13.50 kcal/mol
Antiterminator:    Distance from promoter:113 nt. Size=46 nt.     Delta G= -8.70 kcal/mol
Anti-antiterminator:    Distance from promoter:84 nt.    Size=45 nt.     Delta G=-12.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgcaa-tatact. It has a score value of 72.29 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgcaaaagcttttaagtttttgtatactattttgagtatgaagtatgccaggagtggtggaattggcagacacgctagacttaggatctagtgcctttg
gcgtgtgggttcgactcccaccttctgtaaaaatGCGAAAGTAACTCAGGGGTAGAGTGTCACCTTGCCAAG
GTGGAAGTCGCGGGTTCAAATCCCGTCTTTCGCTttttaataattatcaataaaatttaattgaggcattaacaG
TG

   ف --- tRNA --- Gly --- 2 --- BB0610 Gene: BB0610     GI: 15594955     BI number: BB0610     GOG: COG0544     Description: trigger factor (tig) Gene: BB0611     GI: 15594956     BI number: BB0611     GOG: COG0740     Description: ATP-dependent Clp protease proteolytic component (clpP-1) Gene: BB0612     GI: 15594957     BI number: BB0612     GOG: COG1219     Description: ATP-dependent Clp protease, subunit X (clpX) Gene: BB0613     GI: 15594958     BI number: BB0613     GOG: COG0466     Description: ATP-dependent protease LA (lon-2) Gene: BB0614     GI: 15594959     BI number: BB0614     GOG: -------     Description: B. burgdorferi predicted coding region BB061             C AA       G  C G  A       TA CG        TA GT        CG tA        CG a  A       AT a  C       CG a  T       TG         A a  |      G  A      C  A a  |      T  A      T  A t  |      G  G      T  T gC        AT        GC tA        GC        GC cG       A  |       GC t  |       TG        CG tG        GC        GT cG       G  |      C  | cG       G  |      T  | aT       G  |       GC c  A      A  |       AT c  |       CG        AT cG        TG        GT tA        CG        GC cG        AT        TG aT        AT        GC                         TttttaataattatcaataaaatttaattgaggcattaacaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0544 FKBP-type peptidyl-prolyl cis-trans isomerase (trigger factor) ... can be seen here [OU] COG0740 Protease subunit of ATP-dependent Clp proteases ... can be seen here [O] COG1219 ATP-dependent protease Clp, ATPase subunit ... can be seen here [O] COG0466 ATP-dependent Lon protease, bacterial type ... can be seen here     ..................................................................................................................