                                                                        Gene putatively regulated by attenuation in B_burgdorferi

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:195 nt.     Distance to run of Ts=2 nt.   Size=19 nt.     Delta G= -7.60 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -9.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atgctaggtaatgcctaggggttttaaacctaagaaagtgtcgcagaaaattaccgccgtaaaaggtaagggtgaaaaggtgaggtaagagctcaccgct
tatttagcaataaatacaggcaagataaacctcattaggagcaagatcaagtatgtaagcaccctttgttcttgaggacatgcttacgggtagatcgcac
gatttttttagcgataaaaaaataagagagatgatggcatagtacagaactcggcttatgggtgtcagcttaatttcattgacctaaaagagagttttaa
ATG

    BB0712 --- BB0713 --- BB0714 --- BB0715 --- BB0716 --- BB0717 Gene: BB0714     GI: 15595059     BI number: BB0714     GOG: COG0457     Description: B. burgdorferi predicted coding region BB0714 Gene: BB0715     GI: 15595060     BI number: BB0715     GOG: COG1077     Description: rod shape-determining protein (mreB-1) Gene: BB0716     GI: 15595061     BI number: BB0716     GOG: COG1792     Description: rod shape-determining protein (mreC) Gene: BB0717     GI: 15595062     BI number: BB0717     GOG: -------     Description: conserved hypothetical integral membrane protein Gene: BB0718     GI: 15595063     BI number: BB0718     GOG: COG0768     Description: penicillin-binding protein (pbp-2) Gene: BB0719     GI: 15595064     BI number: BB0719     GOG: COG0772     Description: rod shape-determining protein (mreB-2 aa t  a g  a cg cg gt |  a |  a |  g cg cg at tg ta a  a        a a  a      a  g a  a      t  a a  g      g  g g  |       gc a  |       at cg        gc gt        ta cg        gc ta        gc             gcttatttagcaataaatacaggcaagataaacctcattaggagcaagatcaagtatgtaagcaccctttgttcttgaggacatgcttacgggtagatcgcacgatttttttagcgataaaaaaataagagagatgatggcatagtacagaactcggcttatgggtgtcagcttaatttcattgacctaaaagagagttttaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0457 FOG: TPR repeat ... can be seen here [D] COG1077 Actin-like ATPase involved in cell morphogenesis ... can be seen here [M] COG1792 Cell shape-determining protein ... can be seen here [M] COG0768 Cell division protein FtsI/penicillin-binding protein 2 ... can be seen here [D] COG0772 Bacterial cell division membrane protein ... can be seen here     ..................................................................................................................