                                                                        Gene putatively regulated by attenuation in B_burgdorferi_pl-cp32-1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:215 nt.    Distance to gene:0 nt.     Distance to run of Ts=3 nt.   Size=34 nt.     Delta G= -9.10 kcal/mol
Antiterminator:    Distance from promoter:191 nt. Size=41 nt.     Delta G= -5.30 kcal/mol
Anti-antiterminator:    Distance from promoter:173 nt.    Size=40 nt.     Delta G= -3.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAGT-AAGACT. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAGTATACACTATTATGATAAAAGACTTTTCACCAGTAAGAATCTTATGAATGAAA
TGAAATACTTTTTCGAAAAAGTAGAGTTAATTTATAGTTATATGCAATAAattagtgaactgc
tatttctaaatcaaaaattatagaaatagcagcgaactaaatcaataaaagctaacagatattccctgttaaatatcaagaagttatcagtttatgttaa
caattaacaaattgctttactatttagagtaacaaattgttacttttgttattttagaggatttttTTG

    BBP41 --- BBP42 --- BBP01 --- BBP02 --- BBP03 --- BBP04 --- BBP05 --- BBP06 --- BBP07 --- BBP08 --- BBP09 --- BBP10 --- BBP11 --- BBP12 --- BBP13 --- BBP14 --- BBP15 --- BBP16 --- BBP17 --- BBP18 --- BBP19 --- BBP20 --- BBP21 --- BBP22 Gene: BBP41     GI: 11497089     BI number: BBP41     GOG: -------     Description: hypothetical protein Gene: BBP42     GI: 11497063     BI number: BBP42     GOG: NOG40513     Description: conserved hypothetical protein Gene: BBP01     GI: 11497090     BI number: BBP01     GOG: -------     Description: hypothetical protein Gene: BBP02     GI: 11497091     BI number: BBP02     GOG: -------     Description: hypothetical protein Gene: BBP03     GI: 11497092     BI number: BBP03     GOG: -------     Description: hypothetical protein Gene: BBP04     GI: 11497093     BI number: BBP04     GOG: -------     Description: hypothetical protein Gene: BBP05     GI: 11497094     BI number: BBP05     GOG: -------     Description: hypothetical protein Gene: BBP06     GI: 11497064     BI number: BBP06     GOG: -------     Description: conserved hypothetical protein Gene: BBP07     GI: 11497065     BI number: BBP07     GOG: -------     Description: conserved hypothetical protein Gene: BBP08     GI: 11497066     BI number: BBP08     GOG: -------     Description: conserved hypothetical protein Gene: BBP09     GI: 11497067     BI number: BBP09     GOG: -------     Description: conserved hypothetical protein Gene: BBP10     GI: 11497068     BI number: BBP10     GOG: -------     Description: conserved hypothetical protein Gene: BBP11     GI: 11497095     BI number: BBP11     GOG: -------     Description: hypothetical protein Gene: BBP12     GI: 11497096     BI number: BBP12     GOG: -------     Description: hypothetical protein Gene: BBP13     GI: 11497097     BI number: BBP13     GOG: -------     Description: hypothetical protein Gene: BBP14     GI: 11497098     BI number: BBP14     GOG: -------     Description: hypothetical protein Gene: BBP15     GI: 11497099     BI number: BBP15     GOG: -------     Description: hypothetical protein Gene: BBP16     GI: 11497100     BI number: BBP16     GOG: -------     Description: hypothetical protein Gene: BBP17     GI: 11497101     BI number: BBP17     GOG: -------     Description: hypothetical protein Gene: BBP18     GI: 11497102     BI number: BBP18     GOG: -------     Description: hypothetical protein Gene: BBP19     GI: 11497069     BI number: BBP19     GOG: -------     Description: conserved hypothetical protein Gene: BBP20     GI: 11497070     BI number: BBP20     GOG: -------     Description: conserved hypothetical protein Gene: BBP21     GI: 11497071     BI number: BBP21     GOG: -------     Description: conserved hypothetical protein Gene: BBP22     GI: 11497072     BI number: BBP22     GOG: -------     Description: conserved hypothetical protei             a   a       t  t c  a      c  t at        at at        ta ta        tg ta        ta        tt gc        cg       g  a ta        gt       t  c a  |       ta       t  t t  |       ta        at ta       a  c       at ta       a  a       at gt       a  |       cg at       c  |       at cg       a  |       at |  c      a  |       ta t  t       ta        gt a  t       ta        at t  t       at        gt ta        at        at gc        cg        ta at        at        tg                         aggatttttTTG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_burgdorferi_pl-cp32-1                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:217 nt.    Distance to gene:11 nt.     Distance to run of Ts=2 nt.   Size=21 nt.     Delta G= -6.30 kcal/mol Antiterminator:    Distance from promoter:203 nt. Size=21 nt.     Delta G= -3.80 kcal/mol Anti-antiterminator:    Distance from promoter:155 nt.    Size=40 nt.     Delta G= -3.50 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TTGAGT-AAGACT. It has a score value of 64.93 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTGAGTATACACTATTATGATAAAAGACTTTTCACCAGTAAGAATCTTATGAATGAAA TGAAATACTTTTTCGAAAAAGTAGAGTTAATTTATAGTTATATGCAATAAattagtgaactgc tatttctaaatcaaaaattatagaaatagcagcgaactaaatcaataaaagctaacagatattccctgttaaatatcaagaagttatcagtttatgttaa caattaacaaattgctttactatttagagtaacaaattgttacttttgttattttagaggatttttTTG     BBP41 --- BBP42 --- BBP01 --- BBP02 --- BBP03 --- BBP04 --- BBP05 --- BBP06 --- BBP07 --- BBP08 --- BBP09 --- BBP10 --- BBP11 --- BBP12 --- BBP13 --- BBP14 --- BBP15 --- BBP16 --- BBP17 --- BBP18 --- BBP19 --- BBP20 --- BBP21 --- BBP22 Gene: BBP41     GI: 11497089     BI number: BBP41     GOG: -------     Description: hypothetical protein Gene: BBP42     GI: 11497063     BI number: BBP42     GOG: NOG40513     Description: conserved hypothetical protein Gene: BBP01     GI: 11497090     BI number: BBP01     GOG: -------     Description: hypothetical protein Gene: BBP02     GI: 11497091     BI number: BBP02     GOG: -------     Description: hypothetical protein Gene: BBP03     GI: 11497092     BI number: BBP03     GOG: -------     Description: hypothetical protein Gene: BBP04     GI: 11497093     BI number: BBP04     GOG: -------     Description: hypothetical protein Gene: BBP05     GI: 11497094     BI number: BBP05     GOG: -------     Description: hypothetical protein Gene: BBP06     GI: 11497064     BI number: BBP06     GOG: -------     Description: conserved hypothetical protein Gene: BBP07     GI: 11497065     BI number: BBP07     GOG: -------     Description: conserved hypothetical protein Gene: BBP08     GI: 11497066     BI number: BBP08     GOG: -------     Description: conserved hypothetical protein Gene: BBP09     GI: 11497067     BI number: BBP09     GOG: -------     Description: conserved hypothetical protein Gene: BBP10     GI: 11497068     BI number: BBP10     GOG: -------     Description: conserved hypothetical protein Gene: BBP11     GI: 11497095     BI number: BBP11     GOG: -------     Description: hypothetical protein Gene: BBP12     GI: 11497096     BI number: BBP12     GOG: -------     Description: hypothetical protein Gene: BBP13     GI: 11497097     BI number: BBP13     GOG: -------     Description: hypothetical protein Gene: BBP14     GI: 11497098     BI number: BBP14     GOG: -------     Description: hypothetical protein Gene: BBP15     GI: 11497099     BI number: BBP15     GOG: -------     Description: hypothetical protein Gene: BBP16     GI: 11497100     BI number: BBP16     GOG: -------     Description: hypothetical protein Gene: BBP17     GI: 11497101     BI number: BBP17     GOG: -------     Description: hypothetical protein Gene: BBP18     GI: 11497102     BI number: BBP18     GOG: -------     Description: hypothetical protein Gene: BBP19     GI: 11497069     BI number: BBP19     GOG: -------     Description: conserved hypothetical protein Gene: BBP20     GI: 11497070     BI number: BBP20     GOG: -------     Description: conserved hypothetical protein Gene: BBP21     GI: 11497071     BI number: BBP21     GOG: -------     Description: conserved hypothetical protein Gene: BBP22     GI: 11497072     BI number: BBP22     GOG: -------     Description: conserved hypothetical protei   t g  t aa at gc aa ag ct t  | a  | tt at         a         a aa       t  t      a  t at       c  t      a  t tg        at        cg |  t       ta        at t  t       tg        at g  a       ta        ta t  a       cg        gc cc        gt        at ca        ta        gt ca        ta        at                         tgttattttagaggatttttTTG     ..................................................................................................................