                                                                        Gene putatively regulated by attenuation in B_burgdorferi_pl-cp32-3

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:67 nt.    Distance to gene:16 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-12.20 kcal/mol
Antiterminator:    Distance from promoter:13 nt. Size=69 nt.     Delta G= -4.95 kcal/mol
Anti-antiterminator:   Size=65 nt.     Delta G= -7.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttaat-taagat. It has a score value of 69.61 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttaatttgaaaaaagaatcttataagatatttattaagaaaagctaaaaaagatttcgaaataaaataaatggtttttataagcataaattatgaataa
caagattagctactagtcttgttattttattaatattggagaatcATG

    BBS43 --- BBS44 --- BBS45 --- BBS01 --- BBS02 --- BBS03 --- BBS04 --- BBS05 --- BBS06 --- BBS07 --- BBS08 --- BBS09 --- BBS10 --- BBS11 --- BBS12 --- BBS13 --- BBS14 --- BBS15 --- BBS16 --- BBS17 --- BBS18 --- BBS19 --- BBS20 --- BBS21 --- BBS22 Gene: BBS43     GI: 11497134     BI number: BBS43     GOG: -------     Description: hypothetical protein Gene: BBS44     GI: 11497135     BI number: BBS44     GOG: -------     Description: hypothetical protein Gene: BBS45     GI: 11497124     BI number: BBS45     GOG: NOG40513     Description: conserved hypothetical protein Gene: BBS01     GI: 11497136     BI number: BBS01     GOG: -------     Description: hypothetical protein Gene: BBS02     GI: 11497137     BI number: BBS02     GOG: -------     Description: hypothetical protein Gene: BBS03     GI: 11497138     BI number: BBS03     GOG: -------     Description: hypothetical protein Gene: BBS04     GI: 11497139     BI number: BBS04     GOG: -------     Description: hypothetical protein Gene: BBS05     GI: 11497140     BI number: BBS05     GOG: -------     Description: hypothetical protein Gene: BBS06     GI: 11497125     BI number: BBS06     GOG: -------     Description: conserved hypothetical protein Gene: BBS07     GI: 11497126     BI number: BBS07     GOG: -------     Description: conserved hypothetical protein Gene: BBS08     GI: 11497127     BI number: BBS08     GOG: -------     Description: conserved hypothetical protein Gene: BBS09     GI: 11497128     BI number: BBS09     GOG: -------     Description: conserved hypothetical protein Gene: BBS10     GI: 11497129     BI number: BBS10     GOG: -------     Description: conserved hypothetical protein Gene: BBS11     GI: 11497141     BI number: BBS11     GOG: -------     Description: hypothetical protein Gene: BBS12     GI: 11497142     BI number: BBS12     GOG: -------     Description: hypothetical protein Gene: BBS13     GI: 11497143     BI number: BBS13     GOG: -------     Description: hypothetical protein Gene: BBS14     GI: 11497144     BI number: BBS14     GOG: -------     Description: hypothetical protein Gene: BBS15     GI: 11497145     BI number: BBS15     GOG: -------     Description: hypothetical protein Gene: BBS16     GI: 11497146     BI number: BBS16     GOG: -------     Description: hypothetical protein Gene: BBS17     GI: 11497147     BI number: BBS17     GOG: -------     Description: hypothetical protein Gene: BBS18     GI: 11497148     BI number: BBS18     GOG: -------     Description: hypothetical protein Gene: BBS19     GI: 11497130     BI number: BBS19     GOG: -------     Description: conserved hypothetical protein Gene: BBS20     GI: 11497131     BI number: BBS20     GOG: -------     Description: conserved hypothetical protein Gene: BBS21     GI: 11497104     BI number: BBS21     GOG: -------     Description: conserved hypothetical protein Gene: BBS22     GI: 11497105     BI number: BBS22     GOG: -------     Description: conserved hypothetical protei             t           a  a           c  a           g  a            at            at            ta            at            tg   a        ta a  a       ta a  a      |  t ta        ta cg        ta g  a       gc a  |      g  a at       t  a at       a  g at       a  a gc       a  | |  g      t  | |  a      a  | |  a      a  | |  a      a  | |  t      a  | a  a      t  | a  a      a  | ta       a  | ta       a  | at       g  | ta       c  | ta       t  |        t ta       t  |      c  a at       t  |       gc tg       a  |       at |  g      g  |       ta |  t      a  |       tg at       a  |       at gt       a  |       gc at       a  |       at at        at        at ta        at        cg at        ta        at ta        cg        at ta        gc        ta cg        at        at                         tttattaatattggagaatcATG     ..................................................................................................................