                                                                        Gene putatively regulated by attenuation in B_burgdorferi_pl-cp32-8

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:215 nt.    Distance to gene:0 nt.     Distance to run of Ts=3 nt.   Size=34 nt.     Delta G= -9.10 kcal/mol
Antiterminator:    Distance from promoter:191 nt. Size=41 nt.     Delta G= -5.30 kcal/mol
Anti-antiterminator:    Distance from promoter:173 nt.    Size=40 nt.     Delta G= -3.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAGT-AAGACT. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAGTATACACTATTATGATAAAAGACTTTTCACCAGTAAGAATCTTATGAATGAAA
TGAAATACTTTTTCGAAAAAGTAGAGTTAATTTATAGTTATATGCAATAAattagtgaactgc
tatttctaaatcaaaaattatagaaatagcagcgaactaaatcaataaaagctaacagatattccctgttaaatatcaagaagttatcagtttatgttaa
caattaacaaattgctttactatttagagtaacaaattgttacttttgttattttagaggatttttTTG

    BBL42 --- BBL43 --- BBL01 --- BBL02 --- BBL03 --- BBL04 --- BBL05 --- BBL06 --- BBL07 --- BBL08 --- BBL09 --- BBL10 --- BBL11 --- BBL12 --- BBL13 --- BBL14 --- BBL15 --- BBL16 --- BBL17 --- BBL18 --- BBL19 --- BBL20 --- BBL21 --- BBL22 Gene: BBL42     GI: 11497311     BI number: BBL42     GOG: -------     Description: hypothetical protein Gene: BBL43     GI: 11497292     BI number: BBL43     GOG: NOG40513     Description: conserved hypothetical protein Gene: BBL01     GI: 11497312     BI number: BBL01     GOG: -------     Description: hypothetical protein Gene: BBL02     GI: 11497313     BI number: BBL02     GOG: -------     Description: hypothetical protein Gene: BBL03     GI: 11497314     BI number: BBL03     GOG: -------     Description: hypothetical protein Gene: BBL04     GI: 11497315     BI number: BBL04     GOG: -------     Description: hypothetical protein Gene: BBL05     GI: 11497316     BI number: BBL05     GOG: -------     Description: hypothetical protein Gene: BBL06     GI: 11497293     BI number: BBL06     GOG: -------     Description: conserved hypothetical protein Gene: BBL07     GI: 11497294     BI number: BBL07     GOG: -------     Description: conserved hypothetical protein Gene: BBL08     GI: 11497295     BI number: BBL08     GOG: -------     Description: conserved hypothetical protein Gene: BBL09     GI: 11497296     BI number: BBL09     GOG: -------     Description: conserved hypothetical protein Gene: BBL10     GI: 11497297     BI number: BBL10     GOG: -------     Description: conserved hypothetical protein Gene: BBL11     GI: 11497317     BI number: BBL11     GOG: -------     Description: hypothetical protein Gene: BBL12     GI: 11497318     BI number: BBL12     GOG: -------     Description: hypothetical protein Gene: BBL13     GI: 11497319     BI number: BBL13     GOG: -------     Description: hypothetical protein Gene: BBL14     GI: 11497320     BI number: BBL14     GOG: -------     Description: hypothetical protein Gene: BBL15     GI: 11497321     BI number: BBL15     GOG: -------     Description: hypothetical protein Gene: BBL16     GI: 11497322     BI number: BBL16     GOG: -------     Description: hypothetical protein Gene: BBL17     GI: 11497323     BI number: BBL17     GOG: -------     Description: hypothetical protein Gene: BBL18     GI: 11497324     BI number: BBL18     GOG: -------     Description: hypothetical protein Gene: BBL19     GI: 11497298     BI number: BBL19     GOG: -------     Description: conserved hypothetical protein Gene: BBL20     GI: 11497299     BI number: BBL20     GOG: -------     Description: conserved hypothetical protein Gene: BBL21     GI: 11497300     BI number: BBL21     GOG: -------     Description: conserved hypothetical protein Gene: BBL22     GI: 11497301     BI number: BBL22     GOG: -------     Description: conserved hypothetical protei             a   a       t  t c  a      c  t at        at at        ta ta        tg ta        ta        tt gc        cg       g  a ta        gt       t  c a  |       ta       t  t t  |       ta        at ta       a  c       at ta       a  a       at gt       a  |       cg at       c  |       at cg       a  |       at |  c      a  |       ta t  t       ta        gt a  t       ta        at t  t       at        gt ta        at        at gc        cg        ta at        at        tg                         aggatttttTTG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_burgdorferi_pl-cp32-8                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:217 nt.    Distance to gene:11 nt.     Distance to run of Ts=2 nt.   Size=21 nt.     Delta G= -6.30 kcal/mol Antiterminator:    Distance from promoter:203 nt. Size=21 nt.     Delta G= -3.80 kcal/mol Anti-antiterminator:    Distance from promoter:155 nt.    Size=40 nt.     Delta G= -3.50 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TTGAGT-AAGACT. It has a score value of 64.93 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTGAGTATACACTATTATGATAAAAGACTTTTCACCAGTAAGAATCTTATGAATGAAA TGAAATACTTTTTCGAAAAAGTAGAGTTAATTTATAGTTATATGCAATAAattagtgaactgc tatttctaaatcaaaaattatagaaatagcagcgaactaaatcaataaaagctaacagatattccctgttaaatatcaagaagttatcagtttatgttaa caattaacaaattgctttactatttagagtaacaaattgttacttttgttattttagaggatttttTTG     BBL42 --- BBL43 --- BBL01 --- BBL02 --- BBL03 --- BBL04 --- BBL05 --- BBL06 --- BBL07 --- BBL08 --- BBL09 --- BBL10 --- BBL11 --- BBL12 --- BBL13 --- BBL14 --- BBL15 --- BBL16 --- BBL17 --- BBL18 --- BBL19 --- BBL20 --- BBL21 --- BBL22 Gene: BBL42     GI: 11497311     BI number: BBL42     GOG: -------     Description: hypothetical protein Gene: BBL43     GI: 11497292     BI number: BBL43     GOG: NOG40513     Description: conserved hypothetical protein Gene: BBL01     GI: 11497312     BI number: BBL01     GOG: -------     Description: hypothetical protein Gene: BBL02     GI: 11497313     BI number: BBL02     GOG: -------     Description: hypothetical protein Gene: BBL03     GI: 11497314     BI number: BBL03     GOG: -------     Description: hypothetical protein Gene: BBL04     GI: 11497315     BI number: BBL04     GOG: -------     Description: hypothetical protein Gene: BBL05     GI: 11497316     BI number: BBL05     GOG: -------     Description: hypothetical protein Gene: BBL06     GI: 11497293     BI number: BBL06     GOG: -------     Description: conserved hypothetical protein Gene: BBL07     GI: 11497294     BI number: BBL07     GOG: -------     Description: conserved hypothetical protein Gene: BBL08     GI: 11497295     BI number: BBL08     GOG: -------     Description: conserved hypothetical protein Gene: BBL09     GI: 11497296     BI number: BBL09     GOG: -------     Description: conserved hypothetical protein Gene: BBL10     GI: 11497297     BI number: BBL10     GOG: -------     Description: conserved hypothetical protein Gene: BBL11     GI: 11497317     BI number: BBL11     GOG: -------     Description: hypothetical protein Gene: BBL12     GI: 11497318     BI number: BBL12     GOG: -------     Description: hypothetical protein Gene: BBL13     GI: 11497319     BI number: BBL13     GOG: -------     Description: hypothetical protein Gene: BBL14     GI: 11497320     BI number: BBL14     GOG: -------     Description: hypothetical protein Gene: BBL15     GI: 11497321     BI number: BBL15     GOG: -------     Description: hypothetical protein Gene: BBL16     GI: 11497322     BI number: BBL16     GOG: -------     Description: hypothetical protein Gene: BBL17     GI: 11497323     BI number: BBL17     GOG: -------     Description: hypothetical protein Gene: BBL18     GI: 11497324     BI number: BBL18     GOG: -------     Description: hypothetical protein Gene: BBL19     GI: 11497298     BI number: BBL19     GOG: -------     Description: conserved hypothetical protein Gene: BBL20     GI: 11497299     BI number: BBL20     GOG: -------     Description: conserved hypothetical protein Gene: BBL21     GI: 11497300     BI number: BBL21     GOG: -------     Description: conserved hypothetical protein Gene: BBL22     GI: 11497301     BI number: BBL22     GOG: -------     Description: conserved hypothetical protei   t g  t aa at gc aa ag ct t  | a  | tt at         a         a aa       t  t      a  t at       c  t      a  t tg        at        cg |  t       ta        at t  t       tg        at g  a       ta        ta t  a       cg        gc cc        gt        at ca        ta        gt ca        ta        at                         tgttattttagaggatttttTTG     ..................................................................................................................