                                                                        Gene putatively regulated by attenuation in B_burgdorferi_pl-cp32-9

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:150 nt.    Distance to gene:70 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-17.20 kcal/mol
Antiterminator:    Distance from promoter:123 nt. Size=40 nt.     Delta G= -5.50 kcal/mol
Anti-antiterminator:    Distance from promoter:87 nt.    Size=45 nt.     Delta G= -8.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTAAAG-GAAATT. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTAAAGATAGTTCTAAATTTGAAGAAATTAAAGGATACATCAGTGACAGTCAGTAAtt
atattggatgcttttaggtgtaactaaatttgcgtatacaaagtaacagCTAGTAGAAAAGTTCACTGGCTGTTATTTT
TTTGTAGATTTCATTGTTATGAATATAGAAATGTTTTCTATCAAAACTTTCATTTAAA
AAATGCCAAAAACTATTG

    BBN41 Gene: BBN41     GI: 11497357     BI number: BBN41     GOG: -------     Description: hypothetical protei tt A  a       ta At       g  t Ta       c  a        A Gt        gc       A  G At        ta        AT Cg        ta        AT T  g      t  |       GC G  a      a  |      A  | At       a  |       TA Cg       a  |       GC |  c       ta        AT At        cg        TG Gt        at        CG T  t      a  a       gC G  t       ta        aT A  a       gc        cG Cg        ta        aT Tg       g  g       aT At        gC        tA Cg        aT        gT At        tA        aT Ta        tG        aT                         TTTTGTAGATTTCATTGTTATGAATATAGAAATGTTTTCTATCAAAACTTTCATTTAAAAAATGCCAAAAACTATTG     ..................................................................................................................