                                                                        Gene putatively regulated by attenuation in B_burgdorferi_pl-lp25

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:111 nt.    Distance to gene:76 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -7.40 kcal/mol
Antiterminator:    Distance from promoter:49 nt. Size=72 nt.     Delta G= -8.70 kcal/mol
Anti-antiterminator:    Distance from promoter:46 nt.    Size=34 nt.     Delta G= -4.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttataa-tagatt. It has a score value of 62.25 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttataaatcttaaagatactttttttagattattaataaatttagaaggtgtatattgggagcaaactctagtgataaatgaatatgatttttgttgtgg
ttgaattcattgaaagttattctatcaacctatttatctaaaaattaagtttttaattaaaaacttaatttttttaaaatatattgttaatattaataat
atatggaaaagatttgtaaataatataaaaggtttttaaaagcatagataATG

    BBE02 --- BBE01 Gene: BBE02     GI: 11496616     BI number: BBE02     GOG: COG1002     Description: B. burgdorferi predicted coding region BBE02 Gene: BBE01     GI: 11496632     BI number: BBE01     GOG: -------     Description: B. burgdorferi predicted coding region BBE0             t           g  t           a  a            at            at            gc           t  t           t  a           a  |           c  |           t  |           t  |           a  |            at            gc            ta            ta            gc            gc           |  t            ta            gt           |  t           |  t gt       |  a t  t      t  t t  g      t  c t  t       gt        at tg        ta       a  t tg        ta        ta at        ta        ta gt        ta        ta tg        ta        ta a  a       at        ta ta        gt        gc at        ta        at at       a  a       at gc        tg        ta ta        at        ta at        at        at at        gt        at                         tttttaaaatatattgttaatattaataatatatggaaaagatttgtaaataatataaaaggtttttaaaagcatagataATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [V] COG1002 Type II restriction enzyme, methylase subunits ... can be seen here     ..................................................................................................................