Gene putatively regulated by attenuation in B_burgdorferi_pl-lp25

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:81 nt.    Distance to gene:28 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-13.10 kcal/mol
Antiterminator:    Distance from promoter:28 nt. Size=56 nt.     Delta G= -4.82 kcal/mol
Anti-antiterminator:    Distance from promoter:9 nt.    Size=41 nt.     Delta G= -3.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgttt-tatgtt. It has a score value of 78.98 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgtttagaaaagaatattgtgatatgtttttccatattataccccagctccttttaagtttgtaaaaatctaggtatatgttattaatataataatatt
aaaaccaaaaactattaattttaatttatgaaaaattaaaattaatagttttattatattttgaattaaatattttacataATG

    BBE10


Gene: BBE10     GI: 11496628     BI number: BBE10     GOG: -------     Description: B. burgdorferi predicted coding region BBE1


            t
          a  a
           at
           ta
           ta
           at
           ta
           ta
           gt
           ta
           at
          |  t
 tt       |  a
g  t      t  a
a  g      a  a        g
 at        ta       t  a
 ta        gc       a  a
 ta        gc        ta
 ta       a  a       ta
 ta       t  a       ta
c  a      c  |       at
c  t      t  |       at
t  |      a  |       ta
c  |      a  |       ta
 gc       a  |       ta
 at       a  |       ta
c  a      a  |       at
c  |      t  |       at
 cg       g  |       ta
 cg        ta        ta
 at        ta        at
 ta        ta        ta
 at        gc        cg
 ta        at        at
                        tttattatattttgaattaaatattttacataATG


    ..................................................................................................................