                                                                        Gene putatively regulated by attenuation in B_burgdorferi_pl-lp28-2

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:76 nt.    Distance to gene:27 nt.     Distance to run of Ts=1 nt.   Size=36 nt.     Delta G= -9.70 kcal/mol
Antiterminator:    Distance from promoter:20 nt. Size=66 nt.     Delta G= -9.20 kcal/mol
Anti-antiterminator:    Distance from promoter:10 nt.    Size=30 nt.     Delta G= -6.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgatt-tacaat. It has a score value of 73.63 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgatttttagcaaaaacgttatacaattacgaaatacctaataatgtaatagttttgacattgttggataacacttggatttttaatccagtctagcta
gaccatattttatttattttttaaaaaataagtaaaatatggtttttttaaaaatttaaaaaaataaaggaattatATG

    BBG28 --- BBG27 --- BBG26 --- BBG25 --- BBG24 --- BBG23 --- BBG22 Gene: BBG28     GI: 11496694     BI number: BBG28     GOG: -------     Description: B. burgdorferi predicted coding region BBG28 Gene: BBG27     GI: 11496671     BI number: BBG27     GOG: -------     Description: conserved hypothetical protein Gene: BBG26     GI: 11496693     BI number: BBG26     GOG: -------     Description: B. burgdorferi predicted coding region BBG26 Gene: BBG25     GI: 11496665     BI number: BBG25     GOG: -------     Description: conserved hypothetical protein Gene: BBG24     GI: 11496685     BI number: BBG24     GOG: -------     Description: B. burgdorferi predicted coding region BBG24 Gene: BBG23     GI: 11496684     BI number: BBG23     GOG: -------     Description: B. burgdorferi predicted coding region BBG23 Gene: BBG22     GI: 11496683     BI number: BBG22     GOG: -------     Description: B. burgdorferi predicted coding region BBG2             t           t  t            ta            ta            at            gc            gc            ta           t  |           c  |           a  |           c  |           a  |           a  |            tg            at            gc            gt            ta            tg        ta            gc       t  a           t  t       ta gt       t  a       ta a  t      a  g       ta t  t      c  a       ta a  t      a  c       at a  g       gc        ta ta        ta        ta gc       |  t       tg ta       t  a       at at       t  t       ta at       t  t       ta tg        gt        ta at        at        ta at        ta        at tg        at        ta cg        at        at                         ggtttttttaaaaatttaaaaaaataaaggaattatATG     ..................................................................................................................