                                                                        Gene putatively regulated by attenuation in B_burgdorferi_pl-lp38

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:120 nt.    Distance to gene:85 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-12.80 kcal/mol
Antiterminator:    Distance from promoter:97 nt. Size=37 nt.     Delta G= -3.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttcact-taaatt. It has a score value of 72.29 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttcactggaaaattaataaaacctaaattaaaatctgcttagcacagcaaagcaattcaaataatattttagagaaaaactaatctacaagctcaaaatc
taataacttgcactaatatttaattatcaaaactttattattaggggagtaataataatatgaaaaaattttcatattattattaatttttagtttaaca
atgcaaatctttgcaacacaagataataagttagagttgaaaaaggtgttgagtatattgcagccgtaatgaaatATG

    BBJ03 Gene: BBJ03     GI: 11496840     BI number: BBJ03     GOG: -------     Description: B. burgdorferi predicted coding region BBJ0   g g  g       aa a  g      a  t ta        at tg        at at        at ta        gc ta        ta at        at ta        ta ta        at t  t       at c  a       ta a  a       at a  t       at a  a       ta at        at cg        at ta        ta             atttttagtttaacaatgcaaatctttgcaacacaagataataagttagagttgaaaaaggtgttgagtatattgcagccgtaatgaaatATG     ..................................................................................................................