                                                                        Gene putatively regulated by attenuation in B_burgdorferi_pl-lp54

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:145 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-13.70 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -6.20 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G= -5.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTAATGTTGTTAAGGTAGCTCAAGGCGCAAGAGATCTTACAAAAGTAATGGCTATTTC
TTTATACATGAGATAGttagatatataaatttataaataattagaggttaaagcaaaaaggtttgaagctaattgtattagtttctgc
cttttTTATTTAATAAGATCAATATTGATCTCCCTATTAAGGCTGTTCTTATGATATAAT
ATATTTTCGTTATGAATATTTACATTTTCAATATTTACTTGCATatttatattcttaactaataaaa
tttgccttaaggaaggagaattaatttTTG

    BBA76 Gene: BBA76     GI: 11496909     BI number: BBA76     GOG: COG1351     Description: thymidylate synthase-complementing protein (thy1 aa a  t t  t at ta at ta a  a g  a       aa at       a  a        g ta       a  g      t  t ta        cg        ta Gt        gt        at At        at        at Ta        at        ta A  g      a  g       cg G  a      t  a       gt A  g      t  a       at G  |      g  g       at T  |      g  |       gc A  |      a  |      t  t Cg        gc       t  | At        at        tg T  |       ta        gc At        ta        gc Ta        at        at Ta        at        at Ta        tg        at Cg        at        at                         TTATTTAATAAGATCAATATTGATCTCCCTATTAAGGCTGTTCTTATGATATAATATATTTTCGTTATGAATATTTACATTTTCAATATTTACTTGCATatttatattcttaactaataaaatttgccttaaggaaggagaattaatttTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG1351 Predicted alternative thymidylate synthase ... can be seen here     ..................................................................................................................