                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:111 nt.     Distance to run of Ts=1 nt.   Size=33 nt.     Delta G=-11.50 kcal/mol
Antiterminator: Size=37 nt.     Delta G=-16.00 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-25.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACGCGCGAGACCTCGCCCGGGCATGCGATCAAGGTGGGCGACGTGCTCACCATCGCGC
TCGACCGCACCGTGCGCGTGTTGAAAGTGATAGCCTTCAACGAGCGCCGCGGCGATGC
CGCCTCGGCGCGCGTGCTCTACGAGGAGCTCGGCGAAGGAAAGCGCAATTAAttgcgcttt
gaattcatttcttggtcgatcaatcgcgcaaagccgtcatgatcggccgtccccgaccttgcggcgccgggccatccgcgctacgcaagccgcgactttt
aaaagagcttttcggagcgttggATG

    bll0157 Gene: bll0157     GI: 27375268     BI number: bll0157     GOG: COG1146     Description: ferredoxi TG A  C GC CG GC GC        CG C  T      A  A GC        TG CG        CG        TA CG        TA       T  A GC        CG        At CG        GC        At GC       T  T       Cg A  G       GC        Gc GC        CG        Cg CG       G  |       Gc AT        CG        At A  |       GC        At C  |       CG        At T  |      G  A      |  g T  |      G  |      G  a C  |      C  |      G  a CG        TA        At GC        CG        At AT        CG        Gc                         atttcttggtcgatcaatcgcgcaaagccgtcatgatcggccgtccccgaccttgcggcgccgggccatccgcgctacgcaagccgcgacttttaaaagagcttttcggagcgttggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1146 Ferredoxin ... can be seen here     ..................................................................................................................