                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:46 nt.     Distance to run of Ts=3 nt.   Size=24 nt.     Delta G=-18.70 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-20.10 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-23.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGACGAGCGCGATGCCACGCTGGAGGCGCGCCAGCAGGCACTGTTCAATTTCGCTAC
AAAACTCTCGACGACGCCGATCGAAGCTACTGCAGATGACGCGCGTGCACTCGGCGAG
GCCGGGCTGAGCGAGCTCGAGCAGCTCGACCTGGTACTGTCGGCCGCGATCTTCGGCT
GGGCCAACCGGCTGATGCATACGCTGGGCGAGCCGCTGGCGCGCCCGGAGGCGCCGTA
AccggcgtctccctgttatttgcaaaattgcacgatcgtcacggcaacttcacttgcgatgcgcgcacATG

    bll0233 Gene: bll0233     GI: 27375344     BI number: bll0233     GOG: -------     Description:   C C  A G  A GC         C GC       G  T TG        CG CG        CG GC        GC GT       A  G CG        GC TA        CG |  T       GC T  G       GC C  C       GC TA        TG AT        CG        AA |  A      G  A      T  c GC       C  G       Gc CG       A  |       Cg GC       T  |       Cg |  T      A  |       Gc CG        CG        Cg CG        GC        Gt G  G       TG        Gc GC       A  C       At CG        GC        Gc TA        TG        Gc                         ctgttatttgcaaaattgcacgatcgtcacggcaacttcacttgcgatgcgcgcacATG     ..................................................................................................................