                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:88 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-23.70 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -7.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGCGCTCAAGGCCAACTGGTCGCCGTCGGCGATCGACAGCGTGACTATTTCGGCGAG
CGGACTTCTGTCCGACATCCACGGCACGTCGGAGTATCGTGCGAACCTCATCAAGGTG
ATGGCGCAGCGTGCGGTGGCCGCCGCAGGCTGAcgatcccgctctagcgactgaacgcaaattttccgcggcgcgc
agaaatgcgcgccgcttttattatgcgcccatgcatgaaaaccgcttgcctcgctggcgggaaggcgagaaaagttaatcagccgattaactcgccccca
agagcaacGTG

    AMACR Gene: AMACR     GI: 27375449     BI number: blr0338     GOG: COG1804     Description: Alpha-methylacyl-CoA racemas   t t  t a  t a  c a  c cg gc cg a  g a  c       aa g  g      g  a t  |       at c  |       cg a  |       gc gc        cg cg        gc gc        cg a  |       gc ta        gc cg        cg ta        gc             ttttattatgcgcccatgcatgaaaaccgcttgcctcgctggcgggaaggcgagaaaagttaatcagccgattaactcgcccccaagagcaacGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1804 Predicted acyl-CoA transferases/carnitine dehydratase ... can be seen here     ..................................................................................................................