Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:137 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G= -9.40 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -7.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGAAAAAGTCGGCACgagggctgcatgatcagagcccggaaggctacggggataccaaaaacggagaaatccaggtcaggtaattaa
ctaacatcttcagcgacttagctcaaattttgggcaatctattgcgggacaccctatatcccgttaaaggtttgtttggtgcggcgccgcaaattgcgcg
caattcgggggcactcccccggccaatccctcaaacctaaagacgctatcgcgctactcaacctgtatgcgcgcgcgtggccggtctttggcactgacag
gaatgaagcgagATG

    bll0370


Gene: bll0370     GI: 27375481     BI number: bll0370     GOG: COG4249     Description:


  t
a  t
 at
 at
 cg         c
 tg       c  t
 cg       c  a
 gc       a  t
|  a      c  a
|  a       at
a  t       gc
t  c       gc
t  t       gc
c  a       cg
 at        gt
 gt       t  t
 cg       t  a
 gc       a  a
a  g       ta
 cg        cg
 tg        tg
 ta        at
            ttgtttggtgcggcgccgcaaattgcgcgcaattcgggggcactcccccggccaatccctcaaacctaaagacgctatcgcgctactcaacctgtatgcgcgcgcgtggccggtctttggcactgacaggaatgaagcgagATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG4249 Uncharacterized protein containing caspase domain ... can be seen here

    ..................................................................................................................