                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:60 nt.     Distance to run of Ts=2 nt.   Size=34 nt.     Delta G=-30.10 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -6.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCCAGTTCGCCGAGACCATCGCGGAGATGGAGGAGGGCCTGAAGGAGCACGAAGGCG
GCGAGCTCGATCTGGCCATCGAGCGGCTGGACCACTACAAGAGCATCCAGCAGCAGCT
CAGCTCGACGGCTATGCATTAAgccccgaggcatcgcttcggggctcgaacgcgaaattcctgcaagaaattcctgaataagtt
cagcgctcgtcacggaagtggcgggcgctgaaactttgttgcactgcgcagccgatagcggcattcttcgcccgcgaatttgttccggggcgggtcacag
ATG

    bll0438 Gene: bll0438     GI: 27375549     BI number: bll0438     GOG: COG2114     Description: aa t  g at at gc ta cg c  c       ga t  g      g  a t  c       cg a  |       at a  |       cg at        tg gc        gc a  g       cg a  t       tg c  |       cg gc        gc ta        cg |  c       gc cg        at cg        cg ta        ta ta        ta             actttgttgcactgcgcagccgatagcggcattcttcgcccgcgaatttgttccggggcgggtcacagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG2114 Adenylate cyclase, family 3 (some proteins contain HAMP domain) ... can be seen here     ..................................................................................................................