Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:175 nt.     Distance to run of Ts=2 nt.   Size=33 nt.     Delta G=-11.20 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -4.44 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGCAAACACCTCGCGGCCGCCCCGCACACAGATCACCCTACGTCCGGAAAGCTGCAT
cttgcctcgtatcaacccgttcaaaccaggcctcaggaaaacttggggtagcgcatgggaatttttggctcgcggattgctgcggcacgtttgtggctgt
ggcggcgcggttagaaagcttctataagcccggaactacttgatgcagcaactcaacctgcccctgcaagcgacccagccggactcgctgacggtgttaa
aataccccttgccgggtataactaacaattgggatttcctacATG

    acnA


Gene: acnA     GI: 27375577     BI number: bll0466     GOG: COG1048     Description: aconitas


 cc
c  g
a  t       aa
a  t      a  a
c  c       gc
t  a       gt
a  a       at
 ta        cg
 gc        tg
c  c       cg
 ta        cg
 cg        gt
 cg       |  a
 gc       |  g
|  c      |  c
|  t      |  g
|  c      |  c
 ta       g  a
 tg        at
 cg        cg
 Ta        cg
            gaatttttggctcgcggattgctgcggcacgtttgtggctgtggcggcgcggttagaaagcttctataagcccggaactacttgatgcagcaactcaacctgcccctgcaagcgacccagccggactcgctgacggtgttaaaataccccttgccgggtataactaacaattgggatttcctacATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[C] COG1048 Aconitase A ... can be seen here

    ..................................................................................................................