                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:17 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-14.70 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -6.40 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-19.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATCGTCGTCGCGCAGGCTCGGGAGCTGACCCAAGGCCGCAAGGCCCAGGATGGCAAA
CAGCACCAGCGTCCCCACATAGGCGAACAGGCGCGCCAGCGTGCCGACGACCTCGTCG
GCGAAATTGGCGAGCGCCAGATGGATCTGGGTGGGAGTTGCGGCCGTGCCGGCCTCAG
GCGACTGCATccatggccttcaggcatggtccaacgttgtcttgaggccggttctcgcatagaagcgctgctcttcctgtttaagcgtcagct
tcgggaacgggctttttcatcggagagtgaacgATG

    asd Gene: asd     GI: 27375612     BI number: bll0501     GOG: COG0136     Description: aspartate-semialdehyde dehydrogenas cc t  a g  a gc        ag tg       t  a |  t      a  a at        cg cg        gc gt        cg        tc gc       t  c      g  a at       c  t       cg c  t      t  |       gc tg        tg        at ta        gc        at cg        gt       t  | cg       |  c      t  | gc       c  t      t  | gc       c  t       gc tg        gc        tg |  g       gc        cg a  t       at        cg c  t      |  g       ta c  c      |  t       ta T  t      |  t      |  c A  c       gt        cg Cg        ta        tg Gc        ta        cg Ta        cg        gc                         tttttcatcggagagtgaacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0136 Aspartate-semialdehyde dehydrogenase ... can be seen here     ..................................................................................................................