                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:108 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-22.80 kcal/mol
Antiterminator: Size=53 nt.     Delta G=-25.90 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G=-16.16 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGCAAGACCTGGATCGTCGACGCCAAGGGCGGCACCTCGATGGTGACGATCTCCAAC
GTCAACCAGTCGAACGGCGTGATCCATGTGGTCGACACCGTGCTGATGCCGGCGACGT
AAcaccgcggcgtcctgtttcatccccgacagggtgctttgagacggcgagccgggggcacccggctcgcatttttgtgaccagcatagcctgccggca
tcgactcgatgtcgtgcgcaggcgtaacgaaagcggacgcatcggcgtatattcggtgtcacacgacgttcaggacggaaccaccATG

    bll0506 --- bll0505 Gene: bll0506     GI: 27375617     BI number: bll0506     GOG: COG4117     Description: - Gene: bll0505     GI: 27375616     BI number: bll0505     GOG: COG2041     Description:   A T  A G  c       ac C  a      g  a A  c       cg Gc        cg Cg        cg G  |      |  t Gc       |  g Cg       |  c Cg       c  t Gc       t  t Tg        at At        cg Gc        ta |  c       tg T  t       ta Cg        gc Gt        tg |  t       cg        gc T  t      |  c      g  a G  c       cg        gc C  a       ta        gc C  t      g  |       gc A  c       cg        cg C  c       gc        cg A  c       gc        gc Gc        cg        at Cg       g  g       gc Ta        cg        cg Gc        cg        gc                         atttttgtgaccagcatagcctgccggcatcgactcgatgtcgtgcgcaggcgtaacgaaagcggacgcatcggcgtatattcggtgtcacacgacgttcaggacggaaccaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG4117 Thiosulfate reductase cytochrome B subunit (membrane anchoring protein) ... can be seen here [R] COG2041 Sulfite oxidase and related enzymes ... can be seen here     ..................................................................................................................