                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:140 nt.     Distance to run of Ts=1 nt.   Size=28 nt.     Delta G= -8.70 kcal/mol
Antiterminator: Size=49 nt.     Delta G=-11.66 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G=-10.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACCTCGGCGAGCACGAGATCGTCGGGCTGGCAATATTGCGTGCAGAGAATGGCTTTCA
Tggcgacaccttcttgagaagcgaagtcttgggcgtttcgaggtggaattatagttggcccgtttctgccggatttagcgcggccctacaatccggattc
tttgtctaagggagcgcgcaggcctatccttgcgtcattgcgagcgcagcgaagcaatccagaatccgtcctgcggaaattgtctggattgcttcgctgc
gctcgcaatgacggaacaagaaggaaatgaaggattcaaacgATG

    bll0527 Gene: bll0527     GI: 27375638     BI number: bll0527     GOG: COG1028     Description: hypothetical oxidoreductas             t           t  g           g  g           a  c           t  c           a  c           t  g tc       t  t g  t       at a  t       at a  g       gc g  g      g  t        g cg       t  g      c  g gc        gc       g  c a  g       gc       c  c at       |  g       gc gt       |  g       at at       a  a       ta gc       g  t      |  c tg       c  t       ta ta       t  t       ta cg        ta        at tg        tg        gc t  t       gc        gc cg        cg        cg cg        gc        cg                         attctttgtctaagggagcgcgcaggcctatccttgcgtcattgcgagcgcagcgaagcaatccagaatccgtcctgcggaaattgtctggattgcttcgctgcgctcgcaatgacggaacaagaaggaaatgaaggattcaaacgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [IQR] COG1028 Dehydrogenases with different specificities (related to short-chain alcohol dehydrogenases) ... can be seen here     ..................................................................................................................