                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:138 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-18.70 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -9.03 kcal/mol
Anti-antiterminator:   Size=60 nt.     Delta G=-20.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGGGCTATCTCGGCCGTCCCAACGACATCATCCTCGCCAAGGACGGTTCGATCCTCG
TCGCCGACGACTGGGCCGGTGCGATCTATCGCATCAGCTACAGCAAGAAGTAGcgcgcggg
cgaatcaaaggctgcggtgggcatgaggcggccgcagcctttttcgtgaatgaccgtcgttccggattgcgcgcccttgcgcgcaagtccggaacccata
accacgactggtggttatggattccgggctcgtgcttcgcacgccccggaatgacaatctcgatagatcggaatccccatcATG

    bll0590 Gene: bll0590     GI: 27375701     BI number: bll0590     GOG: COG2863     Description: CT T  A AT GC CG GC TA GT GC C  A CG GC GT |  A |  C       cg |  A      g  g |  G       cg |  C       gc |  A       cg |  A      G  a        g |  G      A  a      t  a G  A      T  t      a  g TA       G  c       cg CG       A  a       gc AT       A  a      g  g G  A      G  a      g  | C  G      A  g       tg A  |      A  |       gc Gc        Cg        gc Cg        Gc        cg |  c       At        gc Cg        Cg        ta Gc       A  c       cg Cg        Tg        gc Tg        Cg        gc                         tttttcgtgaatgaccgtcgttccggattgcgcgcccttgcgcgcaagtccggaacccataaccacgactggtggttatggattccgggctcgtgcttcgcacgccccggaatgacaatctcgatagatcggaatccccatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG2863 Cytochrome c553 ... can be seen here     ..................................................................................................................