                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:25 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G= -8.80 kcal/mol
Antiterminator: Size=39 nt.     Delta G=-13.10 kcal/mol
Anti-antiterminator:   Size=76 nt.     Delta G=-13.87 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tcccccagaggagagagccctcacccccgcgccttcggcgcgacctctcccgcaagcgggagaggttttggagcccgcggcctgatcgtcgacctcacac
gagcaatgccgcactgcggcgcgacccacgcgtgtgcagcgcgaacggacgaggctgtccgcgtcgcattcgcctatttgacggcttcccttttccagcg
cttgccgctttcgtttcggccgcttacacagtcatgtgaacgtcatatggcgctgctagcgcaagcgcttctttattgacggccaagggaggttttcttg
ATG

    bll0733 Gene: bll0733     GI: 27375844     BI number: bll0733     GOG: COG1653     Description: ABC transporter glycerol-3-phosphate-binding protei   t t  g c  c gc cg gc at c  t c  t t  c t  g t  t t  t c  t c  c c  | t  | tg cg gc gc cg         c |  c      a  g at       a  t gt        gc ta        ta t  c       gt t  a       ta a  c       at t  a       cg c  |       tg cg        gc        ag gt       a  g      t  c c  c      c  c       cg t  |       at        gc ta        cg       |  a at       a  c       ta cg       t  t       cg gt        ta        gc cg        cg        cg ta        gc        gc                         ttctttattgacggccaagggaggttttcttgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG1653 ABC-type sugar transport system, periplasmic component ... can be seen here     ..................................................................................................................