                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:113 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-20.40 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-11.21 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-15.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tcagggaatttaggccccgttgatgaaggaagcgttgcgcggggggccgttggaaaggcgcaaaaagcctcgcctgccctgcgatgggccttgtccgcga
gggtggaaagggctatatcagcgccaattcatcttctcatacgatccgcgtagtgagagtgggcccgaaaggacccgctcttttttattacctgagcgcg
gcttggcggaagatgcggcccggcgagctgccgggagagttccgaagcgggctttgaaatcgtaaccaagccttaaccatcgagcgccttgaccctggat
ATG

    bll0786 --- nusA --- bll0784 Gene: bll0786     GI: 27375897     BI number: bll0786     GOG: COG0779     Description: - Gene: nusA     GI: 27375896     BI number: bll0785     GOG: COG0195     Description: N-utilization substance protein A Gene: bll0784     GI: 27375895     BI number: bll0784     GOG: COG2740     Description:   a t  t        c a  c      t  c ta       a  g cg        gc gc        cg |  g       at gc       |  a gc        tg a  a       at a  a       cg at        ta gt        cg gc        ta ta        tg        aa gt       c  |      g  a gc       t  |       cg gt       a  |       cg at       c  |      c  a gc       t  |       gc c  t      t  |       gc g  c      a  |       gc c  a       at        tg c  t       cg        gc ta        cg        at gc       g  |       gc tg        cg        at ta        gc        gt                         ttttattacctgagcgcggcttggcggaagatgcggcccggcgagctgccgggagagttccgaagcgggctttgaaatcgtaaccaagccttaaccatcgagcgccttgaccctggatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG0779 Uncharacterized protein conserved in bacteria ... can be seen here [K] COG0195 Transcription elongation factor ... can be seen here [K] COG2740 Predicted nucleic-acid-binding protein implicated in transcription termination ... can be seen here     ..................................................................................................................