                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:191 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-20.20 kcal/mol
Antiterminator: Size=31 nt.     Delta G=-12.70 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G=-20.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGTGCCGGTGACGATCATCTCCGGCGCGCTGAGCGACCAAAGCGTGGATTCGCTGTC
GTAGgccgggcgctcgtcatgcccggggcttgtcccgggcatccacgtttttggttccgcgaagtaaggcgtggatggccgggacaagcccggccat
gacgaggttggaatatcttggcaccttaacccactgatataacaacggaacggccatctcgccccttgatcgtgcgttccccgtcgccatctgctagtgg
atagcttgcgcgccggccttgaaccggcgacgtctggagaaaaccATG

    bll0800 Gene: bll0800     GI: 27375911     BI number: bll0800     GOG: COG0694     Description: GA G  T T  T GC CG GC AT A  | A  | C  | CG AT GC CG         g        tt GT       c  t      c  g A  A      t  c       gt G  |      c  a       gc TG        gt        gc Cg        cg        gc Gc        gc        cg |  c       gc        cg |  g       gc        cg |  g      |  g       gc Cg       |  g       ta Gc        cg        at Cg        cg       |  c Gc        gc       c  c |  t       Gt        ta Gc        At        gc Cg        Tg        cg                         tttttggttccgcgaagtaaggcgtggatggccgggacaagcccggccatgacgaggttggaatatcttggcaccttaacccactgatataacaacggaacggccatctcgccccttgatcgtgcgttccccgtcgccatctgctagtggatagcttgcgcgccggccttgaaccggcgacgtctggagaaaaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG0694 Thioredoxin-like proteins and domains ... can be seen here     ..................................................................................................................