                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:59 nt.     Distance to run of Ts=0 nt.   Size=14 nt.     Delta G= -6.20 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-10.10 kcal/mol
Anti-antiterminator:   Size=32 nt.     Delta G= -7.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGCATGAAGCCGCTTACGGCGGCAACTTGTATTGGCGGACGCCCACCGGGCTGGCGTC
GACCTTGATCGCAAGAATGATCGCGTTCCGCCGCAGAGGCAAATGCAATCTGGAATTG
ATCGAAGCCATCTCGGCCTTTGCATGTTGTGCGTTGCGAGAACGGAACTGACGCAGCG
CGCATgatgcaaaggaaagcggcagacctcgcgtcaagcatgcatgccatcgccttcaggcggtttcttcgaggtaacccggcggctaggatggccg
cgacgaaacaaacaataaaggcgggagaaATG

    bll0839 --- bll0838 Gene: bll0839     GI: 27375950     BI number: bll0839     GOG: COG0596     Description: - Gene: bll0838     GI: 27375949     BI number: bll0838     GOG: NOG46682     Description:             c           t  a           g  a            cg            gc           c  a           t  t   g       c  g c  g      c  c g  c      a  a a  a      g  | a  g       at a  a       cg gc        gc gc        gc at       c  a a  c      g  t a  |      a  c       tc cg       a  g      t  a gc       a  |       cg tg        gc        cg at        gc        gc gc        at        cg Ta        at        tg                         tttcttcgaggtaacccggcggctaggatggccgcgacgaaacaaacaataaaggcgggagaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0596 Predicted hydrolases or acyltransferases (alpha/beta hydrolase superfamily) ... can be seen here     ..................................................................................................................