                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:47 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-13.80 kcal/mol
Antiterminator: Size=46 nt.     Delta G=-22.20 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-28.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAGGTCGGGCTTGTCGGGCATCAGCCTGTCCAGCGCCTTGGGGCCGCCCTTGCGCTTC
TCGGCGCGGGCACGAATGGTCTTGAACGGGGTCATGCGGACACGAGCGATTGAGGATA
TGCCACGACAGCAGAATTCGATGGTCCGGTCCAGACCTGCGACGCCCGATGCCCTGCA
TGCCGCGATACGCCGCGGCATGCTCCGGCTCATtggattgacgcgagggggcggccgtgctggtctgcttcttgct
ttttgccgttttggaattcccagacaatttcaatcgcgaacggatttcaaATG

    bll0856 Gene: bll0856     GI: 27375967     BI number: bll0856     GOG: -------     Description: AC T  G       gg A  C      t  a GC       T  t CG        At GC        Cg CG        Ta CG       |  c GC        Cg         g TA        Gc       t  c AT       |  g      g  t CG       |  a       cg GC       G  g       cg |  T       Cg       |  t T  C       Cg        gc C  C       Tg        gt CG        Cg        cg CG        Gc       g  | GC        Tg        gc |  T      A  |       gt |  C       Cg        gt TA        Gc        gc AT        Gc        at Gt        Cg        gt Cg        Gt        cg Cg        Cg        gc                         tttttgccgttttggaattcccagacaatttcaatcgcgaacggatttcaaATG     ..................................................................................................................