Gene putatively regulated by attenuation in B_japonicum
Characteristics of the secondary structures
Terminator: Distance to gene:20 nt. Distance to run of Ts=0 nt. Size=25 nt. Delta G=-10.10 kcal/mol
Antiterminator: Size=47 nt. Delta G= -5.19 kcal/mol
Anti-antiterminator: Size=50 nt. Delta G= -7.40 kcal/mol
Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
CTTCTCGGGCAAAATGACGGCCCGATGTTAGAAGCACTGAAACAATTGAACGGCAGGA
ACATTCGCCTGCCGGGCAGGGCGAAAGACCATCCTGACAGAGATCGATTGGCTATGCG
TTTCGAGCGCTACAAGTCTGTTGCGTGAcagcaatgcgcctcttgccaaaaccagattaaagcgtgttgagcatcatcg
gcctcaagcgccttgcaaatgcactccgtcctgacagattgatcccgattcatacgttcgaaggcgacagcttctcgaacttttttagcaacgttacttg
ccgcaATG
bll0880 --- bsl0879
Gene: bll0880 GI: 27375991 BI number: bll0880 GOG: ------- Description: -
Gene: bsl0879 GI: 27375990 BI number: bsl0879 GOG: ------- Description:
aa
a t
cg
gc tc
ta a c
t c gc
c t tg
c c ta
gc at
cg gt
gt a c
| c c a
a c a t
at g a
cg t c ac
ta c g g a
c c c t cg
c a t t gc
g | gc gt
g | cg at
cg c a | c
ta ta at
| t cg gc
at a | cg
cg cg ta
ta gc ta
at tg gc
ttttttagcaacgttacttgccgcaATG
..................................................................................................................