                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:25 nt.     Distance to run of Ts=1 nt.   Size=34 nt.     Delta G= -9.64 kcal/mol
Antiterminator: Size=24 nt.     Delta G=-23.50 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-14.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCTCCAGAGCATGTATCACTTCAAGGTCAAGGTCGATCCGAACGTCGCCTGGGCCGT
GCTCGAGCCGGTGCGCGAGCTGAAGATCGAAGACATGGACGTTCCCGTCCGCAACAAG
CGCTGAgctttcttgcttcacctcccccgcttgcgggggaggccgggtgggggctcttctcgctcgggggttctcgattgctgagacaccctctcc
ccaaccctcccccgcaagcgggggagggagcgcagcgtgatcgcggatacatctccattttattcgccaaactcggtcgaaacatcgaATG

    bll0886 --- bll0885 --- bll0884 --- bll0883 Gene: bll0886     GI: 27375997     BI number: bll0886     GOG: COG0411     Description: ABC transporter ATP-binding protein Gene: bll0885     GI: 27375996     BI number: bll0885     GOG: COG0410     Description: ABC transporter ATP-binding protein Gene: bll0884     GI: 27375995     BI number: bll0884     GOG: COG0559     Description: ABC transporter permease protein Gene: bll0883     GI: 27375994     BI number: bll0883     GOG: COG4177     Description: ABC transporter permease protei   c a  c c  c at gc at gc t  c c  c                 ga gc                 t  t ta                  gc ta                  cg a  c                 gc g  c       aa       a  g c  c      c  g      c  g t  t       gc       g  a c  |       cg       c  t t  |       cg       g  a t  |       cg       a  c gc        cg       g  a gc        cg        gt gc        ta        gc gc        cg        at gc        cg        gc cg        cg        gc                         attttattcgccaaactcggtcgaaacatcgaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0411 ABC-type branched-chain amino acid transport systems, ATPase component ... can be seen here [E] COG0410 ABC-type branched-chain amino acid transport systems, ATPase component ... can be seen here [E] COG0559 Branched-chain amino acid ABC-type transport system, permease components ... can be seen here [E] COG4177 ABC-type branched-chain amino acid transport system, permease component ... can be seen here     ..................................................................................................................