Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:99 nt.     Distance to run of Ts=3 nt.   Size=36 nt.     Delta G=-18.29 kcal/mol
Antiterminator: Size=62 nt.     Delta G=-26.00 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G=-24.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCTGCCCAAGACCGCCACCTCGGCCGAGCTGAAGATGATCGGAGGTCTGGTCCTGAT
CGTGCTCGCCCTGATCCTGTTCGTGTTCAACCGGCGTCAGCCCTTGCTCACTGACGCC
GCTTGAgagaggagcctccccgaactcctctgttagcgcgcgcggctgcccgtcccctacccaacggccgcgcgcgcctttttggggaatgtcatt
ccggggcggctcgtagagccgaacccggaatctcgaggttccgggttctcgctacgcgagccccggaacgacgaacaagagatactcaATG

    bll0976


Gene: bll0976     GI: 27376087     BI number: bll0976     GOG: COG3764     Description:


           cc
          c  c
          t  g
          c  a
 TG       c  a
T  C       gc
C  T       at
C  C       gc
C  A       gc
 GC        at
 AT        gc
 CG        at
 TA       g  g
 GC        At
 CG        Gt
 GC       T  |       cc
 GC        Ta       c  t
 CG        Cg       c  a
C  C       Gc       t  c
 AT        Cg       g  c
 AT       |  c      c  c
 CG        Cg       c  a
 TA        Gc       c  a
 Tg        Cg        gc
G  a      A  |       tg
T  |       Gc        cg
G  |       Tg        gc
 Cg        Cg        gc
 Ta       A  c       cg
 Tg       C  t       gc
G  g      T  |       cg
 Ta        Cg        gc
 Cg        Gc        cg
                        cgcctttttggggaatgtcattccggggcggctcgtagagccgaacccggaatctcgaggttccgggttctcgctacgcgagccccggaacgacgaacaagagatactcaATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[M] COG3764 Sortase (surface protein transpeptidase) ... can be seen here

    ..................................................................................................................