                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:107 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-23.20 kcal/mol
Antiterminator: Size=35 nt.     Delta G= -7.00 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G= -7.54 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TACAATTTCGGCGACGCGCACTTCACCGCGGGCCCGCTGGCGGGCACCGGCAACTTCA
CCACCGACGACCACACCTTCAAGGCGGGCGTCAACTATCGCTTCAACTGGGCCAATTC
GACGGTCGCGCGCTACTGAtcggttagcaaaaccttatcctgacgaagggccggccccgttgccggcccttcttttttcgccctgc
ggaaccagcgcaagcaattgcaccaattgcgatttttttaaccggccccgccgatactgcccgccacaaaacagaagcaagagcgtgggggaagttcgAT
G

    bll1203 Gene: bll1203     GI: 27376314     BI number: bll1203     GOG: COG0840     Description: TC G  G GC CG A  | GC         t CG       c  g T  C      c  a T  T      t  c A  A      a  g A  C       ta C  T       ta        cg C  G       cg       c  t G  A       cg       c  t Gt       a  |       cg Gc       a  |       gc Tg       a  |       gc Cg       a  |       cg At        cg        cg At        gc        gc C  |      a  c       gc T  |      t  g       gc Ta        tg        at Cg        gc        at Gc        gc        gc                         ttttttcgccctgcggaaccagcgcaagcaattgcaccaattgcgatttttttaaccggccccgccgatactgcccgccacaaaacagaagcaagagcgtgggggaagttcgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NT] COG0840 Methyl-accepting chemotaxis protein ... can be seen here     ..................................................................................................................