                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:89 nt.     Distance to run of Ts=3 nt.   Size=31 nt.     Delta G= -8.50 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-10.00 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G=-10.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGCCATGGCGCCGCGGCCGCGACCTCGATCTCGCTCAGCTTCGAGACGGTGCTGCTG
TTCTGGATCGTGCGGCAGCGCCTCGGCCTGCACGTTCTGGCGTTTGGAAAATAGccgctc
gcctgccctgccccttggggaacgcctattgcgtaacgggctcggaaacgaggcgaaacgactgccattcgccggtcggtagcatgatttttcttatttg
atccaagaggttgcttcccagggaaaatttattctacgtcatattgcccaactgacgagataaacctaagattccccagaccATG

    bll1489 Gene: bll1489     GI: 27376600     BI number: bll1489     GOG: COG0730     Description:   a        aa t  t      g  a c  t       gc cg        cg gc        ta cg        cg at       g  g a  |      g  |       tt g  |       gc       a  c g  |       cg       c  g g  |      a  a      c  c g  |      a  a       gc ta        ta        tg ta        gc        cg c  c       cg        at cg       g  a       gc cg       t  c       cg cg       t  t      a  g gc       a  |      a  t t  t      t  |      a  a c  c      c  |      g  | cg        cg        cg cg        gc        gc                         atgatttttcttatttgatccaagaggttgcttcccagggaaaatttattctacgtcatattgcccaactgacgagataaacctaagattccccagaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0730 Predicted permeases ... can be seen here     ..................................................................................................................