                                                                        Gene putatively regulated by attenuation in B_japonicum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:56 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G= -7.70 kcal/mol
Antiterminator: Size=29 nt.     Delta G= -6.70 kcal/mol
Anti-antiterminator:   Size=26 nt.     Delta G= -4.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ggtagtggctaaaacaggcggcgtctcagcaattcctccgtgcgtatactcagatcaggacaaccgcatctagcgtcgtgcgccacgatttgtcggccga
ccgccggatttcactgatcaatgaagccgtctcgtctgcggcaaccgctggcatcagacggagcggataactgcaccgctaaatatggacacgggcatcg
gactttcgtcgccgtcaggcgcaagtttttttactccgccttgtttggcaagaattctctcgcctacgaccggtatcgcaggaatgcgctaacgcccgat
GTG

    bll1541 Gene: bll1541     GI: 27376652     BI number: bll1541     GOG: -------     Description:            ct at       a  t       tc a  a       gt       g  a at        gc        cg tg        cg        cg cg       t  t       gc |  a      a  c       cg |  c       cg       t  c |  a       gc       g  | gc        gc       c  | cg       g  |      t  | cg       c  |       ta a  |      a  |       ta cg        cg        cg gc        at        at ta        gc        gt                         tttttactccgccttgtttggcaagaattctctcgcctacgaccggtatcgcaggaatgcgctaacgcccgatGTG     ..................................................................................................................