Gene putatively regulated by attenuation in B_japonicum
Characteristics of the secondary structures
Terminator: Distance to gene:197 nt. Distance to run of Ts=0 nt. Size=26 nt. Delta G= -7.60 kcal/mol
Antiterminator: Size=44 nt. Delta G=-11.30 kcal/mol
Anti-antiterminator: Size=43 nt. Delta G=-16.70 kcal/mol
Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
cccgcgcgcgccgccctatcgcctgaagggatttcgttgggacccggcgcaactggaaaaactgcaaggaccgccagatgagggtgagcgccacccgggt
ttattaaccctccgccgatcatgcagaaagacggcaaaaggtggcccatcggcgccgattatggaaccggttgtggtgttaaatgccccgaaacgatggc
agaaacgaaggagatgctccggctccgcatactcggctcacacaccgacgactgacgcaggatcgcccgcgatgacaaagcagagcgagcatagatcagc
ATG
bll1544
Gene: bll1544 GI: 27376655 BI number: bll1544 GOG: ------- Description:
ga
t a
cg c
cg g a
g | ta
cg cg
ta a g
at a a
| t a c
| t a c
| c a g c
| g gc g g
| t gc a c
t t ta gc
cg cg ta
cg a a gc
cg at gc
| a cg gc
| c g a a g
| c c | g |
gc g | t |
cg g | a |
cg cg g |
gc cg a |
cg cg cg
gc at cg
tttattaaccctccgccgatcatgcagaaagacggcaaaaggtggcccatcggcgccgattatggaaccggttgtggtgttaaatgccccgaaacgatggcagaaacgaaggagatgctccggctccgcatactcggctcacacaccgacgactgacgcaggatcgcccgcgatgacaaagcagagcgagcatagatcagcATG
..................................................................................................................